Homework Help Question & Answers

Below are four reads from the same genome (all sequences are shown in the 5’→3’ direction)....

Below are four reads from the same genome (all sequences are shown in the 5’→3’ direction). Assemble them into one continuous sequence. What is the order of the fragments?

Fragment #1: CCGGTATGTGTGTGTG

Fragment #2: CGTACGTGGGGGAAA

Fragment #3: ATGCGATCGTACG

Fragment #4: ATACCGGTTTCCCCC

A. 1-2-3-4

B. 1-3-2-4

C. 1-4-3-2

D. 2-1-4-3

E. 2-3-1-4

F. 2-4-3-1

G. 3-1-4-2

H. 3-2-4-1

I. 3-4-2-1

J. 4-1-2-3

K. 4-2-1-3

L. 4-3-1-2

0 0
Add a comment
Answer #1

G- 3-1-4-2

Note the start of start contain atg thta is start codon and end of strand should have poly A chain so 3 should be first fragment and 2 should be last accordingly only G option have 3 has first and 2 as last fragment remaining two canbe determine withhelp of option available .

Add a comment
Know the answer?
Add Answer to:
Below are four reads from the same genome (all sequences are shown in the 5’→3’ direction)....
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coin

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • The strategy for obtaining a genomic sequence can be divided into four steps: 1) overlap contigs...

    The strategy for obtaining a genomic sequence can be divided into four steps: 1) overlap contigs for complete sequence, 2) sequence each fragment, 3) cut many genome copies in to random fragments, 4) overlap sequence reads. What is the order of the four steps? A) 1, 2, 3, and 4 B) 2, 4, 3, and 1 C) 3, 2, 1, and 4 D) 3, 2, 4, and 1 E) 4, 3, 2, and 1

  • Genetics Question 4 Part B [20 marks] You will use a deBruijn graph to assemble the 10bp circular genome from which the...

    Genetics Question 4 Part B [20 marks] You will use a deBruijn graph to assemble the 10bp circular genome from which these short (7-mer) reads have been derived: Reads: GCAGGTA TAACCGC GTAACCG CCGCAGG AGGTAAC A) Break the reads into the 10 k-mers for k 3 that you can obtain from these reads and write them out next to the reads in your book. [5 marks B) Draw a deBruijn graph using the k-mers as the edges to connect k -...

  • Describe the results of the experiments shown below in which human bladder cancer DNA was used....

    Describe the results of the experiments shown below in which human bladder cancer DNA was used. For part B, why would a researcher complete experiment such as this? In your answer, please differentiate between proto-oncogene and oncogene, and be sure to describe the methods of DNA transfection and foci detection. fordi detected proto-oncogene transfection after transfection cloned oncogene 9.4 acquired fragments carrying oncogene NIH 3T3 genome - fragment reactive with probe b c d e f g h i j...

  • Four lenses are shown below. All four lenses are made of the same transparent material, all...

    Four lenses are shown below. All four lenses are made of the same transparent material, all curved surfaces have the same magnitude of radius of curvature, and all four lenses are shown to the same scale. Rank the four lenses in order of their focal length, from most positive to most negative. Four lenses are shown below. All four lenses are made of the same transparent material, all curved surfaces have the same magnitude of radius of curvature, and all...

  • Align the same two sequences in part one with the new scoring scheme: This question relates...

    Align the same two sequences in part one with the new scoring scheme: This question relates to Bioinformatics --- Genome Sequence Analysis. Below doesn't match the question above but should give you an idea what it should look like. Answer should be in this format: We would like to align two DNA sequences: (v) C GATACT, and (w) GATIC GT based on the following scoring scheme as discussed in class: i) s(i, j) = 1 if Vi = w; (matches);...

  • S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel...

    S-CGT-3 GTG 3. Write in the following sequences to depict them hybridizing/annealing to complementary and antiparallel sequence in the exposed nucleotide chains. 5'-GTG-3 5-CGT-3 5'-ACG-3' | 5 -CAC-3" 5'-AAT[CGTATCAGCAGCAGTG|ACT-3 -3'-TTALGCATAGTCGTCGTCATGA-5'- 3. Two of the four above sequences can be used together as a "primer pair" to PCR amplify the bracketed sequence. In order to determine which two will work, recall that new polynucleotide chains can only be added to on the 3'end. Draw an arrow from the 3' end of...

  • Question 2. True / False (10 marks) Tor F The DNA sequences shown below are complementary...

    Question 2. True / False (10 marks) Tor F The DNA sequences shown below are complementary to each other. AATTGCTACGTT AATTGCTACGTT I or F T or F b. Primase carries polymerase activity. c. In prokaryotes, RNA polymerases synthesize RNA at a lower rate than DNA polymerases because it takes time for RNA polymerase to perform proofreading. d. Reverse transcriptase activity is observed in DNA polymerase I in prokaryotes. The base in the following nucleotide is adenine. This nucleotide can be...

  • O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be...

    O ACTIVITY 5.4.1 Synthesis of a Protein: A Simulation Activity In this activity, you will be provided with the DNA nucleotide sequence that codes for a hypothetical protein. The code will be provided to you in three fragments. You will have to tran- scribe the code into mRNA, remove an intron segment, and translate the mRNA into the protein. In addition, you will have to identify the beginning fragment the middle fragment, and the end fragment. Sequence A TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGC CGCCAGGGCCCCGCCCCTCAGAAGTTGGT...

  • see full photo Vocabulary: DNA Replication A. Helicase B. Primase C. Single Strand Binding Protein (SSB)...

    see full photo Vocabulary: DNA Replication A. Helicase B. Primase C. Single Strand Binding Protein (SSB) D. Topoisomerase E. Origin of Replication F. DNA Polymerase G. Leading Strand H. Lagging strand I. DNA Ligase J. Okazaki Fragment K. Replication Fork L. RNA Primer M. Topoisomerase 1. Site where the replication of a DNA molecule begins The new continuous complementary DNA strand synthesized in the direction for the replication fork.. 4. A discontinuously synthesized DNA strand that elongates in a direction...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT