Question

You are given the below piece of Template DNA (the same as the previous question). How...

You are given the below piece of Template DNA (the same as the previous question). How many amino acids are in the protein en

You are given the below piece of Template DNA (the same as the previous question). How many amino acids are in the protein encoded by this gene? 3'AATACGGGGAGCITTACAGAATTCAAATCA5' SECOND POSITION с A G U phenyl- alanine tyrosine cysteine U serine stop leucine stop tryptophan stop U с A G U с A histidine с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G isoleucine asparagine serine U с A А threonine methionine lysine arginine valine aspartic acid glutamic U с A alanine G glycine acid • and start 4 5 6 7 8 9 10
0 0
Add a comment Improve this question
Answer #1

Sign Up to Unlock the answer FREE

Already have an account? Log in

Template DNA:

3' AATACGGGGAGCTTTACAGAATTCAAATCA 5'

mRNA: synthesized from template strand of DNA from 5' - 3'.

5' UUAUGCCCCUCGAAAUGUCUUAAGUUUAGU 5'

Three nucleotides of mRNA makes a single codon of a gene and code of single amino acid.

5' Leu-Cys-Pro-Ser-Lys-Cys-Leu-Lys-Phe-Ser 3'

As per the table given, codons responsible for amino acids are given. 30 nucleotides code for 10 amino acids. Hence correct option is 10 amino acids.

Add a comment
Know the answer?
Add Answer to:
You are given the below piece of Template DNA (the same as the previous question). How...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • You are given the below piece of Template DNA. What is the third amino acid in...

    You are given the below piece of Template DNA. What is the third amino acid in the protein encoded by this gene? 3'A ATACGGGGAGCTTTACAGAATTCAAATCAS' SECOND POSITION с A U phenyl- alanine tyrosine cysteine U U с A serine leucine stop stop stop tryptophan G histidine U с А с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G isoleucine asparagine serine U с А A threonine lysine arginine methionine G U valine slanine aspartic acid glutamic acid glycine А G...

  • What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND...

    What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND POSITION с A U phenyl- alanine tyrosine cysteine U serine U с A leucine stop stop tryptophan stop G histidine U с A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G U isoleucine asparagine serine A threonine A lysine arginine methionine G U с A valine G aspartic acid glutamic acid alanine glycine and start Cysteine Alanine Arginine Serine

  • There is a mutation in a codon-sequencing triplet of DNA. The sequence of 3' ATG 5'...

    There is a mutation in a codon-sequencing triplet of DNA. The sequence of 3' ATG 5' was mutated so that now it reads 3' ATC 5. What kind of mutation is this? SECOND POSITION с A U phenyl- slanine tyrosine cysteine U U с А serine leucine stop stop stop tryptophan G histidine U С A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION isoleucine asparagine G U с А G serine А threonine methionine lysine arginine valine aspartic...

  • table: The DNA sequence shown below is part of a eukaryotic gene. Note that there are...

    table: The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...

  • Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala)...

    Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala) chou GU Tyrosine (Tyr) A с A Valine (Val) G U Cysteine (Cys) U G START HERE Typtophan (Trp) Arginine (Arg) A G U с A с Leucine (Leu) Serine (Ser) A с UGA Proline (Pro) Lysine (Lys) Asparagine (AST) Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon The anticodon for CCA is...

  • Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...

    Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...

  • Question 24 Refer to the table below to answer the following question. А G U Serine...

    Question 24 Refer to the table below to answer the following question. А G U Serine Serine Serine U с A UAA U с А с w Phenylalanine UCU UUC Phenylalanine UCC UUA Leucine UCA UUG Leucine UCG CUU Leucine CCU CUC Leucine сос CUA Leucine CCA CUG Leucine CCG Isoleucine ACU AUC Isoleucine ACC AUA Isoleucine ACA AUG Methionine Start ACG GUU Valine GCU GUC Valine GCC GUA Valine GCA GUG Valine GCG UAU Tyrosine UAC Tyrosine Stop UAG...

  • B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is...

    B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes? can you help me solve A and B The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...

  • Phenylalanin (Phe) Glycine (Gly) (Glu) Glutamic acid O Leucine (Leu) Serine (Ser) (Asp) Aspartic acid Alanine...

    Phenylalanin (Phe) Glycine (Gly) (Glu) Glutamic acid O Leucine (Leu) Serine (Ser) (Asp) Aspartic acid Alanine (Ala) coroca GU Tyrosine (Tyr) А с Valine (Val) G A G Cysteine (Cys) C U GTyptophan (Trp) START HERE Arginine (Arg) A G U A С Leucine (Leu) Serine (Ser) A с с poleo U G G A Proline (Pro) Lysine (Lys) Asparagine (Asri Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon...

  • The one-letter sequence is: WATER a) Draw the peptide (R-groups trans), indicating charges, in pr...

    The one-letter sequence is: WATER a) Draw the peptide (R-groups trans), indicating charges, in predominant form found at pH = 0. b) What is the isoelectric point? c) What is the average charge on the population of peptide macromolecules at pH = 2.2? d) What is the average charge on the population of peptide macromolecules at pH = 12.5? TABLE 4.1 Amino Acid Alanine Arginine Asparagine Aspartic acid Cysteine....« Glutamic acid Glutamine Glycine Histidine Isoleucine Leucine Lysine … Methionine Phenylalanine...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT