Homework Help Question & Answers

A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....

A mutation is a permanent change in the sequence of nucleotide bases in a cells DNA. Most mutations happen during DNA replicThe following chart shows the same segment of a gene, only now a single nucleotide has been changed somehow, causing a mutati

A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino acid sequence that will be translated from it. Second base U C А. UUU Phenylalanine | UCU Serine UAU Tyrosine UGU Cysteine UUC Phenylalanine UCC Serine UAC Tyrosine UGC Cysteine UUA Leucine UCA Serine UAA stop UGA stop A UUG Leucine UCG Serine UAG stop UGG Tryptophan CUU Leucine CCU Proline CAU Histidine CGU Arginine CUC Leucine CCC Proline | CÁC Histidine CGC Arginine CUA Leucine CCA Proline CAA Glutamine CGA Arginine CUG Leucine CCG Proline CAG Glutamine CGG Arginine AUU Isoleucine ACU Threonine AAU Asparagine AGU Serine Ul AUC Isoleucine ACC Threonine AAC Asparagine AGC Serine C AUA Isoleucine ACA Threonine | ААА Lysine AGA Arginine AUG Methionine ACG Arginine G GUU Valine GCU Alanine GAU Aspartate GGU Glycine U GUC Valine GCC Alanine GAC Aspartate GGC Glycine GUA Valine GCA Alanine GAA Glutamate GGA Glycine GUG Valine GCG Alanine GAG Glutamate GGG Glycine First base Third base Clear highlighting G ? DNA mRNA Amino acid G ? A ? T I A ? C ? ΑΙΑ ? ? ? ?
The following chart shows the same segment of a gene, only now a single nucleotide has been changed somehow, causing a mutation. Type in the new mRNA strand and amino acid sequence that will be translated from it. Mutated DNA G GATI CA AT mRNA ? ? ? Amino acid If you carefully compare the original DNA segment with the mutated DNA segment, you can see that in the mutated segment a single nucleotide base has disappeared from the DNA strand. In this case, the mutation in the DNA segment is the result of mutation. a base pair substitution a deletion an insertion
0 0
Add a comment
Answer #1

Sign Up to Unlock the answer FREE

Already have an account? Log in

DN A G GAT T A CA A MRNA C e u A A UGUU Amino acid Asparegine Valine Proline Muctate DNA A TTCA AT e UA A GUUA MRNA C Amino aThe mutation in DNA segment is the result of a deletion mutation. It is the loss of some part of DNA. It is one type of structural mutation where one nucleotide is lost.

Add a comment
Know the answer?
Add Answer to:
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coin

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • table: The DNA sequence shown below is part of a eukaryotic gene. Note that there are...

    table: The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...

  • B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is...

    B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes? can you help me solve A and B The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...

  • i think it might be Glutamate, but im not sure. Someone please help!! its the last...

    i think it might be Glutamate, but im not sure. Someone please help!! its the last question i need to finish this mindtap. please respond quickly too, its due TODAY at 11:59pm EST CENGAGE MINDTAP a se Chapter 9 Digging Deeper Conceptual Learning Activity Second base U C A G UUU Phenylalanine UCU UUC Phenylalanine UCC Leucine UCA Leucine UCG Leucine CCU Leucine CCC Leucine CCA Leucine CCG Isoleucine ACU Isoleucine ACC Isoleucine ACA Methionine ACG Cysteine U Cysteine C...

  • Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...

    Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...

  • There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The C-terminal...

    There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The C-terminal amino acid is Choose... V NH₃ NH₃ Air ОН 90- NH Choose... glycine alanine valine leucine isoleucine serine threonine cysteine methonine aspartate glutamate asparagine glutamine lysine arginine phenylalanine tyrosine proline histidine

  • options There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The...

    options There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The C-terminal amino acid is Choose... V NH3 NHE ОН 90- NH Choose... glycine alanine valine leucine isoleucine serine threonine cysteine methonine aspartate glutamate asparagine glutamine lysine arginine phenylalanine tyrosine proline histidine

  • 50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise...

    50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...

  • There is a mutation in a codon-sequencing triplet of DNA. The sequence of 3' ATG 5'...

    There is a mutation in a codon-sequencing triplet of DNA. The sequence of 3' ATG 5' was mutated so that now it reads 3' ATC 5. What kind of mutation is this? SECOND POSITION с A U phenyl- slanine tyrosine cysteine U U с А serine leucine stop stop stop tryptophan G histidine U С A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION isoleucine asparagine G U с А G serine А threonine methionine lysine arginine valine aspartic...

  • You are given the below piece of Template DNA. What is the third amino acid in...

    You are given the below piece of Template DNA. What is the third amino acid in the protein encoded by this gene? 3'A ATACGGGGAGCTTTACAGAATTCAAATCAS' SECOND POSITION с A U phenyl- alanine tyrosine cysteine U U с A serine leucine stop stop stop tryptophan G histidine U с А с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G isoleucine asparagine serine U с А A threonine lysine arginine methionine G U valine slanine aspartic acid glutamic acid glycine А G...

  • What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND...

    What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND POSITION с A U phenyl- alanine tyrosine cysteine U serine U с A leucine stop stop tryptophan stop G histidine U с A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G U isoleucine asparagine serine A threonine A lysine arginine methionine G U с A valine G aspartic acid glutamic acid alanine glycine and start Cysteine Alanine Arginine Serine

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT