Homework Help Question & Answers

Given a template strand: 5' AGTATAGTGTTAGGTGTCATAGTACAAGG 3', which of the following could be used as a...


Given a template strand: 5 AGTATAGTGTTAGGTGTCATAGTACAAGG 3, which of the following could be used as a DNA primer? 5 CATAGT
Given a template strand: 5' AGTATAGTGTTAGGTGTCATAGTACAAGG 3', which of the following could be used as a DNA primer? 5' CATAGTACAAGG 3' 5'AGTATAGTGTTA 3' O 5' TAACACTATACT 3' O No one of these primers recognise the given template O 5'CCTTGTACTATG 3'
0 0
Add a comment
Answer #1

The given DNA strand is

5'- AGTATAGTGTTAGGTGTCATAGTACAAGG -3'

The new strand will be synthesized in 5'- 3' direction, therefore primer will bind to 3' end

Therefore the Complementary Sequence of this DNA in 5' -3' direction will be

5'- CCTTGTACTATGACACCTAACACTATACT- 3'

Comparing the 5' sequence with the given primers and we will find the sequence matches with option 5.

Therefore option 5 can be used as a DNA primer

hit like if u find the answer helpful

Thank u

Add a comment
Know the answer?
Add Answer to:
Given a template strand: 5' AGTATAGTGTTAGGTGTCATAGTACAAGG 3', which of the following could be used as a...
Your Answer:

Post as a guest

Your Name:
What's your source?

Earn Coin

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Below is a sequence of double-stranded DNA that will be used as a template in the...

    Below is a sequence of double-stranded DNA that will be used as a template in the polymerase chain reaction (PCR). The goal is to use this as a template to make a a PCR product that includes the shaded area. The sequence of one of the PCR primers is given below. Template DNA: 5' - CTTAGCGCTGTTGGGGGCCAACTATCACACACACCACACACAGGTATAAATGGCATTTGATACAGATTG - 3' 3' - GAATCTGTATCAAATGCCATTTATACCTGTGTGTGGTGTGTGTGATAGTTGGCCCCCAACAGCGCTAAG - 5' If the sequence of one of the primers is 5' TTGTGGGGCC 3' which of the following primers...

  • DNA is double stranded, but only one strand is used as a template for transcription. How...

    DNA is double stranded, but only one strand is used as a template for transcription. How does the cellular machinery determine which strand to use as the template? Choose the best answer. O It always starts on the 5' end. O The sequence of the DNA that will be transcribed determines which strand will be used. O It always starts on the 5' end closest to the centromere. O The location and orientation of the promoter determine which strand will...

  • If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What...

    If the DNA template strand sequence at a particular region of a gene is 3-GGA-5. What amino acid would this result in after transcription and translation? Pro (Proline) Ser (Serine) Val (Valine) Arg (Arginine) Question 20 1 pts What is created during transcription? a strand of codons O a strand of tRNA a strand of anticodons a polypeptide • a strand of DNA IPS Which letter (representing a phase of the cell cycle) would you observe (S phase) synthesis and...

  • 1. If a template strand reads: 3’-TTG CAA TGC AAC-5’ what will the new strand read?...

    1. If a template strand reads: 3’-TTG CAA TGC AAC-5’ what will the new strand read? 2. How are new nucleotide monomers attached to the growing strand? What is the reaction that takes place? How is dATP different from ATP? 3. Why does the lagging strand exist? 4. In the lagging strand, what is the enzyme that replaces the RNA primer with DNA? What enzyme then connects the two fragments together? 5. The replication machinery is very accurate but every...

  • 1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA,...

    1. Using the following terms, describe the process of transcription a. Template strand, non-template/coding strand, DNA, RNA, RNA polymerase, 3 5, 5 3', uracil, promoter, termination sequence, enhancer, nucleus, cytoplasm. What process often follows transcription? How is the genetic code used in this process ?

  • You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and...

    You have the following mRNA sequence: 5’-GCAUGAUAUGCGAGCUAHCAUGACGU-3’ What is the DNA coding strand, template strand, and tRNA sequence. Where is the start and stop codons and provide the resultant polypeptide sequence

  • dentify the correct action and event for clamp loading proteins catalyzes the joining of deoxyribonucleotide 5...

    dentify the correct action and event for clamp loading proteins catalyzes the joining of deoxyribonucleotide 5 -triphosphates (dNTPs) to form the growing DNA chain O an enzyme that can synthesize short fragments of RNA de novo which are complementary to the parent strand template and serve as primers for DNA replication proteins that specifically recognize and bind DNA at the junction between the primer and template proteins that bind adjacent to the clamp-loading proteins, forming a ring around the template...

  • CHAPTER 14: Identify the primer sequences that could be used in this PCR reaction shown below...

    CHAPTER 14: Identify the primer sequences that could be used in this PCR reaction shown below to amplify the target region highlighter in pink (which could be an important gene such as insulin that you want to make many copies of). At this point, the double-stranded DNA has been heated so that the strands are now in a single-strand formation. Be sure to pay attention to the DNA sequence and the 5' 3'ends of the primers. 5' GG CCA A...

  • Given the DNA template strand 3\' CGATGAGCC 5\', write the amino acid sequence in the N-terminal...

    Given the DNA template strand 3\' CGATGAGCC 5\', write the amino acid sequence in the N-terminal to C-terminal direction. Use the three-letter amino acid abbreviations (for example, Glu-Asp-Val).

  • 3. A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment of DNA is cloned...

    3. A primer used in dideoxy DNA sequencing is 5’GGATCCATGACTAGTCCGAC-3’. A segment of DNA is cloned into a vector and then the vector DNA is denatured and subjected to dideoxy DNA sequencing method. Below is the DNA sequence from a region of the vector. 5’GGGCTAGCCGGATCCATGACTAGTCCGACTTACTGACCATCGACTCATCC-3’ 3-CCCGATCGGCCTAGGTACTGATCAGGCTGAATGACTGGTAGCTGAGTAGG-5’ To which DNA strand does the primer bind, the top or bottom one? Based on the sequence above, what would be the sizes of the bands (i.e., the number of nucleotides in each band)...

Free Homework App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.