Question

Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...

Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon.

Translate the following mRNA.

AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA

The genetic code

UUU

phenylalanine

UCU

serine

UAU

tyrosine

UGU

cysteine

UUC

phenylalanine

UCC

serine

UAC

tyrosine

UGC

cysteine

UUA

leucine

UCA

serine

UAA

STOP

UGA

STOP

UUG

leucine

UCG

serine

UAG

STOP

UGG

tryptophan

CUU

leucine

CCU

proline

CAU

histidine

CGU

arginine

CUC

leucine

CCC

proline

CAC

histidine

CGC

arginine

CUA

leucine

CCA

proline

CAA

glutamine

CGA

arginine

CUG

leucine

CCG

proline

CAG

glutamine

CGG

arginine

AUU

isoleucine

ACU

threonine

AAU

asparagine

AGU

serine

AUC

isoleucine

ACC

threonine

AAC

asparagine

AGC

serine

AUA

isoleucine

ACA

threonine

AAA

lysine

AGA

arginine

AUG

Methionine START

ACG

threonine

AAG

lysine

AGG

arginine

GUU

valine

GCU

alanine

GAU

aspartate

GGU

glycine

GUC

valine

GCC

alanine

GAC

aspartate

GGC

glycine

GUA

valine

GCA

alanine

GAA

glutamate

GGA

glycine

GUG

valine

GCG

alanine

GAG

glutamate

GGG

glycine

0 0
Add a comment Improve this question
Answer #1

Sign Up to Unlock the answer FREE

Already have an account? Log in

Translation- The process of polymerisation of amino acids to form polypeptide. The sequence of amino acids are given belowStart Codon stopcodon AACAcc[HO GAcc CÁCHUAGGGGGA GIGI ACOUAGIO AGCGGAGG, GIGUGIUA MUA I Glycine Aspartate valine Glutamate !

Add a comment
Know the answer?
Add Answer to:
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is...

    B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes? can you help me solve A and B The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...

  • i think it might be Glutamate, but im not sure. Someone please help!! its the last...

    i think it might be Glutamate, but im not sure. Someone please help!! its the last question i need to finish this mindtap. please respond quickly too, its due TODAY at 11:59pm EST CENGAGE MINDTAP a se Chapter 9 Digging Deeper Conceptual Learning Activity Second base U C A G UUU Phenylalanine UCU UUC Phenylalanine UCC Leucine UCA Leucine UCG Leucine CCU Leucine CCC Leucine CCA Leucine CCG Isoleucine ACU Isoleucine ACC Isoleucine ACA Methionine ACG Cysteine U Cysteine C...

  • table: The DNA sequence shown below is part of a eukaryotic gene. Note that there are...

    table: The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...

  • options There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The...

    options There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The C-terminal amino acid is Choose... V NH3 NHE ОН 90- NH Choose... glycine alanine valine leucine isoleucine serine threonine cysteine methonine aspartate glutamate asparagine glutamine lysine arginine phenylalanine tyrosine proline histidine

  • There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The C-terminal...

    There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The C-terminal amino acid is Choose... V NH₃ NH₃ Air ОН 90- NH Choose... glycine alanine valine leucine isoleucine serine threonine cysteine methonine aspartate glutamate asparagine glutamine lysine arginine phenylalanine tyrosine proline histidine

  • A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....

    A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...

  • Question 24 Refer to the table below to answer the following question. А G U Serine...

    Question 24 Refer to the table below to answer the following question. А G U Serine Serine Serine U с A UAA U с А с w Phenylalanine UCU UUC Phenylalanine UCC UUA Leucine UCA UUG Leucine UCG CUU Leucine CCU CUC Leucine сос CUA Leucine CCA CUG Leucine CCG Isoleucine ACU AUC Isoleucine ACC AUA Isoleucine ACA AUG Methionine Start ACG GUU Valine GCU GUC Valine GCC GUA Valine GCA GUG Valine GCG UAU Tyrosine UAC Tyrosine Stop UAG...

  • 50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise...

    50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...

  • Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala)...

    Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala) chou GU Tyrosine (Tyr) A с A Valine (Val) G U Cysteine (Cys) U G START HERE Typtophan (Trp) Arginine (Arg) A G U с A с Leucine (Leu) Serine (Ser) A с UGA Proline (Pro) Lysine (Lys) Asparagine (AST) Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon The anticodon for CCA is...

  • What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND...

    What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND POSITION с A U phenyl- alanine tyrosine cysteine U serine U с A leucine stop stop tryptophan stop G histidine U с A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G U isoleucine asparagine serine A threonine A lysine arginine methionine G U с A valine G aspartic acid glutamic acid alanine glycine and start Cysteine Alanine Arginine Serine

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT