Homework Help Question & Answers

11 Department of Biological Sciences BIOCHEMISTRY Test 2.2018 H. Nucleic Acid, Sequencing of DNA: Amino Acids...


11 Department of Biological Sciences BIOCHEMISTRY Test 2.2018 H. Nucleic Acid, Sequencing of DNA: Amino Acids Hydrolysis of s
1. The DNA strand complementary to the strand 5-GTAGCGTAT-3 would have the sequence: a. 5-TACGCATAT-3 b. 3-CATCGCATA-5 c.


7-11. Identify the following structures 7. Adenine 8. Cuanine 9. Cytosine 10. Thymine 11. Uracil 12. The recognition sequence
13. The amino acid is attached to the group on ribose of adenine nucleotide in tRNA: a. at 3 position b. at 5 position. c.


Table 154 The Centle Code 2988 88 The Wa Second Position 52 LAC UAG Si UAA Slap UAUTY Tyr CUGI therefore about in the CCA CG


17.Do de cNA leics derivnd Gm difleret sell tres wihin the e im der from eh other a yes 18. DNA from Micrococcus bysodeiticus
gh HPO 1o p ACPJ0 a 1210 2510 S10 4610 4 73 1 The in d o f v e of 200dW in te pt of de finl uti? pk f this ad is 82 25 A in m
32. All the st A) Pro d amino acids except e optically ative B) Arg ) Tep D) Gly E) Phe 33. The amino acid compositiom of the
LA n 1-Valine 40. 41. 42 41 Poline L-Serine L-Throonine 44 COO HC CH O NHI N CH, н-с-сH с NH NH2 н. COo н C-CHy н-с NHI он Е
11 Department of Biological Sciences BIOCHEMISTRY Test 2.2018 H. Nucleic Acid, Sequencing of DNA: Amino Acids Hydrolysis of salt Laboratory buffers, Polyprotie acids QUESTIONS 1. The DNA strand complementary to the strand 3-GTAGCGTAT-Y' would have the sequence a SLTACOCATAT-3 b.3.CATOXICATA-S c. 3-ATGCGTATA-S" ATATGCGTAS 2. When cytosine is treated with bisulfite, the amino group is replaced with a carbonyl group. Identify the resulting base a. adenine b. guanine c uracil d. thyminee. typoxanthine 3. How many amino acids would be in the protein encoded by a gene with the sequence 3-TACAGCCOGGATTCA-S": a. 5 b. 2 c. 4 d.6 e. 12 4. If a tRNA molecule specialized for transfer of the amino acid ARGININE has the anticodon 3' UCUS, with what codon on mRNA will it bybridize?: a. 5 CAG 3' b. S' GUC 3' c. 5 GTC 3' d. 3 AGA S'e. 5 GAC 3 5. The enzymes that break down foreign, as opposed to native, DNA are called: a helicases b. depolymerases c. restriction endonucleases d. ligases e topoisomerases ceplor 6. Enzyme that transfers a phosphoryl group from a nucleoside triphosphate to an molecule is called: alipase b. DNA polymerase e. phosphatase d. hydrolase e. kinase
1. The DNA strand complementary to the strand 5-GTAGCGTAT-3' would have the sequence: a. 5'-TACGCATAT-3' b. 3-CATCGCATA-5' c. 3'-ATGCGTATA-5' d. 3-ATATGCGTA-5 2. When cytosine is treated with bisulfite, the amino group is replaced with a carbonyl group. Identify the resulting base. a. adenine b. guanine c. uracil d. thyminee. hypoxanthine 3. How many amino acids would be in the protein encoded by a gene with the sequence 3-TACAGCCCGGATTCA-5'?: 2.5 b. 2 c. 4 d.6 c. 12 4. If a tRNA molecule specialized for transfer of the amino acid ARGININE has the anticodon 3 UCU 5, with what codon on mRNA will it hybridize?: a. 5'CAG 3 b. 5' GUC 3' c. 5'GTC 3' d. 3' AGA 5' e. 5 'GAC3 5. The enzymes that break down foreign, as opposed to native, DNA are called: a, helicases b. depolymerases c. restriction endonucleases d. ligases e. topoisomerases 6. Enzyme that transfers a phosphoryl group from a nucleoside triphosphate to an acceptor molecule is called: a. ligase b. DNA polymerase c. phosphatase d. hydrolase. e. kinase
7-11. Identify the following structures 7. Adenine 8. Cuanine 9. Cytosine 10. Thymine 11. Uracil 12. The recognition sequence for the restriction enzyme Taql is T|CGA. Indicate the products of the reaction of Taql with the DNA sequence shown. 5'-ACGTCGAATC-3' 3'-TGCAGCTTAG-5' a. 5'-ACGTCGAAT-C-3" 3 - TGCAGCITA-G-5' b. 5'-ACGT - CGAATC-3' c. 5'-ACGT ---CGAATC-3' 3'-TGCA - GCTTAG-5' 3'-TGCAGC -- TTAG-S' d. 5'-ACGTCGAAT - C-3' 3-TGCAGC - TTAG-5' e. 5'-ACGTCGAAT-C-3' 3'-T - GCAGCTTAG-5°
13. The amino acid is attached to the group on ribose of adenine nucleotide in tRNA: a. at 3' position b. at 5' position. c. at 2' position d. at 3' or 2 positions 14. Find, using the genetic code, the amino acid sequence of a peptide synthesized on the following template of mRNA: AUG UUA AUU ACC GCU GAU GGA AGU AGA GUA UGA a. Met Leu Thr Lys Ala Gly Ser Pro Gly Ala b. Met Leu Ile Thr Ala Asp Gly Ser Arg Val c. Leu Thr Gly Ala Val Pro His Lys Arg His d. Met Gly Val Ile Val Ala Pro His Gln Ser e. Met Val Thr Leu Ile Ala Pro Glu His Gly 3338 8339
Table 154 The Centle Code 2988 88 The Wa Second Position 52 LAC UAG Si UAA' Slap UAUTY Tyr CUGI therefore about in the CCA CGC GOU UGC ACC Ars AGAL AGUS UT suco Bucu SU las Third Position End) 15 - 16. Match the term with its description: a. cDNA library b. shuttle vectors c. genomic library d. linkers e. cDNAs 15. Restriction fragments of DNA from a given organism inserted into plasmid and amplified in a bacterial colony. 16. Products of reverse transcription reaction inserted into the plasmid and amplified in a bacterial colony.
17.Do de cNA leics derivnd Gm difleret sell tres wihin the e im der from eh other a yes 18. DNA from Micrococcus bysodeiticus hs the base composition (A TG O-041 the sae e compnition in ENA fom the phe 17 is 1.78 Which of tde two types of DNA will have a higher meting point Tm? b. Micrococc lyodeitic a phage T2 19. Dideoxy method of DNA gaencing gave the following electropheeetic paern of prohcts of de chemical sytis of unkwn DNA Deduce the sequence of the unknown original DNA fragment ь УСАЛОСАGA e. 5-AGATOGG a. 5-TAAGTGG0 4 СстооСса с. 5-ТСТАОСса 20. Calculate the plH of a 2 L solution containing 10 mL. of 5 M acetic acid and 10 ml. of 1 M sodium acctate. pK, for acetic acid is 4.76. c. 2.75 a. 205 b 3.45 d. 4.06 e 1.75 21. What is pkK of the weak acid in a solution containing 0.1 M HA and 0.2 MA and has a pll of 6.5? a. 5.65 b. 6.75 c. 6.2 d. 7.25 e. 4.75 22. What is the pli of a buffer solution containing 0.01 M HPO and 0.01 M PO- pKa- 12.32 a. 9.32 b. 7.22 c 13.36 d. 12.32 e. 11.56 23. Calculate the pli of a 0.05 M solution of ethanolamine (NHCH-CH OH). K-2.8 x 10 b. 6.03 a. 11.07 d. 835 c. 7.05 e. 9.56
gh HPO 1o p ACPJ0 a 1210 2510 S10 4610 4 73 1 The in d o f v e of 200dW in te pt of de finl uti? pk f this ad is 82 25 A in me y ising s0md. of 2 MKaP d 25 md of 20 MKRP a 634 h345 4.56 d 785 7.12 2Gyci kCHENCICOOT id a carylic acid grosp and an ammonium group and ther is w minacid Awotion containing 0.01 M Gycine hydrochloride and 0.2 Mof the mondicitod species (C1NCHCOO has pl-2.65. What is the pk of this disociation 7 aL.75 b 215 235 e. 3.45 d. 3.05 27. What is the pli of a solution prepared by dissolving 5.35 g of NHCI in I Liter of 0.2 M NH,7 N-14, H-1, a-35. b. 9. 56 e 1145 a 7. 58 c. 10. 46 d. b.8.35 28. Calculate the pH of 0.1 M solution of isolectric Alanine. pkal-2.34, pKa-9.69 a 602 b. 234 c. 4.68 d. 167 e 117 29. Calculate the hydrolysis constant pKs for the acctic acid with pK.-4. 75 a 2.25 c. 3.75 d. 5.45 e. 9.25 h. 7, 85 30. Calculate the isolectric plH for Glutamic acid with pKa-2.10, pKa-9.47, and pKs- 4.07 a 5.8 b. 3.08 e. 4.07 d. 4.08. e. 6.77 31. At pH 7, aspartic acid (pKs are a-carboxylate 1.99, a-amino 9.9, Bcarboxylate 3.9) would be charged as follows: A) 0 a-carboxylate, +1 a-amino, 0 B-carboxylate, +1 net charge B) +1 a-carboxylate, -I a-amino, +1 B-carboxylate, +1 net charge C) -I a-carboxylate, +1 a-amino, -1 B carboxylate, -1 net charge D) 0 a-carboxylate, -I a-amino, 0 B-carboxylate, -1 net charge E) +1 a-carboxylate, +1 a-amino, +1 pcrboxylate, +3 net charge
32. All the st A) Pro d amino acids except e optically ative B) Arg ) Tep D) Gly E) Phe 33. The amino acid compositiom of the Gihutathione is A) eG-K-L B) A-C-G D) aC-G-K E) yG-QE 34. Caloulate the degree of dissociation of a 0.05 m weak acid with K.-5x 10e a 0.05. b as. e. 0.01. d 08 e. 0.02 35. Identify amino acids with uncharged polar side chains A). G,A, V. L, L, M, P. F. W S, T, N, Q, C C) K, R, H, D, E B). K, R, L, I, P, G E) D). F, W, K, R, D 36. 2 moles of glucose dissolved in 1000 ml of solution at a pressure of 1 at will have osmotic pressure equal to: a 73 atm b 11.2 atm c. 22.4 atm d. 1 atm e. 44.8 atm 37. A protein molecule placed in a buffer of pll below its isolectric point would have its net charge: a negative b. positive 38. Calculate the pH of 1 L solution containing 0.1 M formic acid and (Ka- 1.78 x 10-4) and 0.1 M sodium formate. е. 3,75 a. 2.55 b. 4.75 c. 3.55 d. 1.78 39. Caleulate the pH of a 0.1 M solution of aspartic hydrochloride. pKal pKa3-9.82 A. 0.84 2.0, pKa2-3.86, В. 1.44 C. 2.04 D. 3.76 E. 1.56 40-44. Identify following amino acids on the attached diagram:
LA n 1-Valine 40. 41. 42 41 Poline L-Serine L-Throonine 44 COO HC CH O NHI N CH, н-с-сH с NH NH2 н. COo н C-CHy н-с NHI он Е 45. Alanine has pK,-2.35. Calculate its pKsa. a 9.69 b. 6.02 c. 10.65 d. 11.65 e. 4.61 h
0 0
Add a comment
Answer #1

1) the DNA strand complementary to 5'-GTAGCGTAT-3' is 3'-CATCGCATA-5'. SO the correct option is (b).

2) Cytosine when deaminated forms uracil

3)3' TAC AGC CCG GAT TCA 5' will have 5 amino acids.

4)3' UCU 5' will hybridise with 3' AGA 5'

5)restriction endonuclease breaks down the foreign DNA into fragments.

6)Kinase transfers phosphoric group from a triphosphate to an acceptor.

Add a comment
Know the answer?
Add Answer to:
11 Department of Biological Sciences BIOCHEMISTRY Test 2.2018 H. Nucleic Acid, Sequencing of DNA: Amino Acids...
Your Answer:

Post as a guest

Your Name:
What's your source?

Earn Coin

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Suppose part of the amino acid sequence of a protein is N... Gly - Ala -...

    Suppose part of the amino acid sequence of a protein is N... Gly - Ala - Pro - Arg - Lys ...C. Which of the following amino acid sequences could result from a frameshift mutation (+1 or -1) in the part of the gene that encodes this sequence of amino acids? Ο N... Gly - Ala - Asn - Ser - Leu ...C Ο Ν...Αla - Ala - Arg - Pro - Lys...C Ο Ν...Gly - Gly - Thr -...

  • What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА...

    What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...

  • 22. Fill blanks in the table below 5'- (4) -3 5-AGA-3' DNA triplet of template strand...

    22. Fill blanks in the table below 5'- (4) -3 5-AGA-3' DNA triplet of template strand 5'-(5) -3' 5- (1) -3 MRNA codon 3'-UUG-5 5'- (2) -3 tRNA anticodon (6) (3) Amino Acid 3rd position 2nd position 1st position (3' end) G (5' end) C U Cys Cys STOP Trp Tyr Tyr STOP Ser Ser Ser Ser Phe Phe Leu STOP Leu Arg Arg His Pro Leu His Pro Leu Arg Arg Gln Pro Leu Gln Pro Leu Ser Ser...

  • Question Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly-Phe-Met Select codons from the following table. If more than one codon is possible for a given amino acid, ch...

    Question Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly-Phe-Met Select codons from the following table. If more than one codon is possible for a given amino acid, choose only one If there are fewer than 8 amino acids in the peptide, leave the corresponding codons blank. Enter your answer in ALL CAPS, ie, "ATG" not "atg" Third base (3" end) First base (5' end) Second baseUCAG Phe Phe Leu Leu SerSer Ser Ser U Leu Leu...

  • Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...

    Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...

  • The next DNA sequence is the MATRICE strand of a small gene. What is the complete...

    The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...

  • 2) On your first day working in my lab, you obtain the following DNA sequence: 3'...

    2) On your first day working in my lab, you obtain the following DNA sequence: 3' AATTATACACGATGAAGCTTGTGACAGGTTTCCAATCATTAA 5 5' TTAATATGTGCTACTTCGAACACTGTECCAAAGGTTAGTAATT 3' a) What are the two possible RNA molecules that could be transcribed from this DNA? Indicate the 5' and 3' ends of the RNA. b) Only one of these two RNA molecules can actually be translated. Explain why. c) It turns out that the RNA molecule that can be translated is the mRNA for p53. What is the amino...

  • 15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...

    15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...

  • A small generic section of the primary structure of an alpha helix is given below -amino...

    A small generic section of the primary structure of an alpha helix is given below -amino acid1-amino acid2-amino acid3-amino acid4-amino acid5-amino acid-6-amino acid7- a.) which amino acid residue's backbone forms a hydrogen bond witht he backbone of the seventh(7th) residue? 6, 1, 3, 2, 5, OR 7? b.) which of the following peptide segments is most likely to be part of a stable alpha helix at physiological pH? a.) -Lys-Lys-Ala-Arg-Ser- b.) -Gly-Arg-Lys-His-Gly- c.) -Pro-Leu-Thr-Pro-Trp- d.) -Gly-Gly-Gly-Ala-Gly- e.) -Glu-Glu-Glu-Glu-Glu- f.) -Glu-Leu-Ala-Lys-Phe-...

  • Question 5 Bio206 Homework 6 Amino Acids and Proteins Organic Chemistry II Due May 6, 2017 1. Which amino acid is least likely to be found in a natural protein? CH20H NHz CHs IV 2. A pentapeptide has...

    Question 5 Bio206 Homework 6 Amino Acids and Proteins Organic Chemistry II Due May 6, 2017 1. Which amino acid is least likely to be found in a natural protein? CH20H NHz CHs IV 2. A pentapeptide has the molecular formula: Asp, Glu, His, Phe, Val. Partial hydrolysis of the pentapeptide gives: Val Asp, Glu His, Phe Val, and Asp Glu. What is the amino acid sequence of the pentapeptide? 3. When the pentapeptide below is heated first with 2,4-dinitrofluorobenzene...

Free Homework App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.