Question

Incorrect Question 5 0/2 pts What effect would the deamination of 5-methylcytosine in a promoter have on the expression of th
0 0
Add a comment Improve this question Transcribed image text
Answer #1

The deamination of 5- methylcytosine to lead to the conversion of cytosine to thymine that increased the expression. Deamination is the reaction involving of amino group. Hence, correct option is e.

Add a comment
Know the answer?
Add Answer to:
Incorrect Question 5 0/2 pts What effect would the deamination of 5-methylcytosine in a promoter have...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Question 2 3 pts AP (apurine or apyrimidine) site is a result of what kind DNA...

    Question 2 3 pts AP (apurine or apyrimidine) site is a result of what kind DNA damage? Thymine-thymine dimer. Adenine Guanine mismatch error. Cytosine to Uracil deamination. O ionizing radiation.

  • 0/2 pts Incorrect Question 5 If pressure increased by 4, volume would Increased by 2 Show...

    0/2 pts Incorrect Question 5 If pressure increased by 4, volume would Increased by 2

  • Question 3 1 pts What would happen to the expression of this gene if this cell...

    Question 3 1 pts What would happen to the expression of this gene if this cell did not have any GAL4 protein and why? It would be always off because GAL4 activates transcription . it would be always on because GAL80 won't be able to bind DNA without GAL4 it would be always on because GAL4 inhibits transcription it would only be on when galactose is present Question 4 1 pts What would happen to the expression of this gene...

  • answer all the questions 1) All of the following contribute to promoter binding by RNA polymerase...

    answer all the questions 1) All of the following contribute to promoter binding by RNA polymerase I in bacteria except: a)-10 consensus sequence b)-35 consensus sequence c) rho factor d) sigma factor e) none of the above 2) Common structural changes or lesions found in DNA after exposure to ultraviolet light are: a) thymine dimers b) cytosine dimers c) purine dimers d) adenine dimers e) none of the above 3) What is the function of the sigma subunit in the...

  • please help with all 3 Incorrect Question 19 0/10 pts The sequence below represents the first...

    please help with all 3 Incorrect Question 19 0/10 pts The sequence below represents the first section of the coding strand of DNA of a structural gene in an prokaryotic organism. Position +1 is shown in orange. Please fill in the blanks that correspond. YOUR RESPONSES SHOULD ALL BE IN UPPER CASE. Amino acid sequences should be written in the format ALA-TYR-LEU Stop codon is not written. 5' GTAACTATAATTATGCGTATAATG 3' What would be the nucleotides that form the promoter? GUAACUAU...

  • Question 6: 10 pts 5 pts (A) Draw the structure of: 1. Deoxyadenylic acid 2. Uridine...

    Question 6: 10 pts 5 pts (A) Draw the structure of: 1. Deoxyadenylic acid 2. Uridine (B) Draw the two different dipeptides from L-tyrosine and L-alanine, showing the following in each structure. 1. the stereochemistry of the chiral centers 2. the N terminal 3. the C terminal 4, the peptide bond H3C OH OH NH2 NH2 HO L-alanine L-tyrosine ΝΗ, N pyrimidine purine NH O NH H,C, NH "NH NH NH H H H cytosine ( uracil (U; occurs in...

  • Any help with my bio question would be apprecaited! For each of the following, describe whether:...

    Any help with my bio question would be apprecaited! For each of the following, describe whether: (1) transcription or post-transcription requlation, (2) gene expression is increased or decreased and (3) molecular process affected 1. Deletion of enhancer 1. Transcription, decreased, RNA polymerase cannot initiate transcription 2. Increased polyadenylation of mRNA 3. Decrease in histone acetylation in promoter 4. Removal of 5' CAP 5. Deletion of the TATA Box 6. Inhibition of SiRNA Lsynthesis

  • Question 11 2 pts What effect does the purchase of government bonds have on the US...

    Question 11 2 pts What effect does the purchase of government bonds have on the US economy (in the short run)? Increased consumption Decreased investment Decrease in the CPI Unclear Question 12 2 pts Suppose a person named Erica borrows $10,000 in 2018 which she needs to pay back to the "Bank of Segura" in a year. The nominal interest rate is 10% while the inflation rate is 35%. How much will Erica need to pay back in 2019? $1,000...

  • Incorrect Question 9 0/2 pts A first order reaction with a k=0.216 (with units expressed in...

    Incorrect Question 9 0/2 pts A first order reaction with a k=0.216 (with units expressed in hours). How long in hours, to have 87.5% of the original concentration remaining. Answer to 2 decimal places. 0.62 Partial Question 6 1.5/3 pts The following reaction was run four times: NO(g) + Cl2le) - NOCIE) What is the order of reaction with respect to: NO- 1/2 C12= 1 Solve for the reaction constant (proportionality constant): k= 1.14 X10 -5 (Answer to 2 decimal...

  • Question 5 (5 pts): For what function has evolution favored the preservation of CpG dinucleotides at...

    Question 5 (5 pts): For what function has evolution favored the preservation of CpG dinucleotides at gene promoters? Question 6 (10 pts): What is meant by saying that regulatory activity at gene promoters alone cannot be responsible for a cell's overall program of cell-type differentiation? Question 7 (5 pts): Why is phosphorylation of certain serine residues on the C-terminal domain of RNA Pol II so important during gene transcription? Question 8 (5 pts): Why is alternative RNA splicing so important...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT