Question

You are given a DNA sequence that reads: TCGAGGTCACCG If a mutation occurs that causes the first A in the sequence to be de

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Answer is 1st option that is the first ,third and fourth amino acid are correct, but the second amino acid will be incorrect. Because if first A in sequence got deleted that lead to change in codon that codes for amino acid. As codon changed the particular amino acid will be changed hence option 1st is correct.

Add a comment
Know the answer?
Add Answer to:
You are given a DNA sequence that reads: TCGAGGTCACCG If a mutation occurs that causes the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • A DNA coding sequence of ATGCGTGGA(sequence for the rest of the gene)AATTAA encodes a protein chain...

    A DNA coding sequence of ATGCGTGGA(sequence for the rest of the gene)AATTAA encodes a protein chain of 200 amino acids of MET-ARG-GLY-(196 more amino acids)-ASN after splicing. A mutation occurs in which the third G is changed to a T. Using the genetic code below, determine which type of mutation this is and briefly explain how translation will be affected for this protein chain.

  • A substitution mutation occurs which changes the amino acid sequence of the active site in an...

    A substitution mutation occurs which changes the amino acid sequence of the active site in an enzyme. What will happen to substrate binding as a result of this mutation? A) It will increase B) It will decrease C) It will be eliminated D) It will be unchanged E) Either B or C F) It depends upon what amino acid is substituted My first choice was E, which is incorrect, my second choice is now F.

  • 1) When a mutation occurs by elimination of one base in a DNA sequence, this mutation...

    1) When a mutation occurs by elimination of one base in a DNA sequence, this mutation is called a Explain. a) deletion mutation b) substitution (point) mutation c) translocation mutation d) viral mutation 2) Acids and bases denature a protein by disrupting peptide bonds and salt bridges amide bonds and alkene bonds hydrophobic interactions and peptide bonds Aluminum reacts with sulfuric acid. It produces a gas, and an aqueous solution. What mass (in g) of aluminum would completely react with...

  • 4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This...

    4. Imagine the following DNA sequence is a real sequence of a gene (coding strand). This gene has only one exon meaning no sequence is spliced out during RNA processing. a) What will be the amino acid sequence this gene codes for? 15 points will be given for a completely correct amino acid sequence. You can get partial points if: the beginning of the amino acid sequence is correct (at least two first amino acids, 4 points), and/or the end...

  • DNA to Protein Describe the mutation that created the HbS allele: type of mutation, location of...

    DNA to Protein Describe the mutation that created the HbS allele: type of mutation, location of mutation on HbA sequence (# of bases from beginning of sequence), nucleotide change (from which base to which base?). Describe the effect of this mutation on amino acid sequence of beta-globin polypeptide chain: effect of mutation on codon, which amino acid was changed (# amino acids from beginning of chain), what was the amino acid change (from which amino acid to which amino acid?)...

  • 1. You have used a mutagen to induce mutations in a DNA sequence.  If the original DNA...

    1. You have used a mutagen to induce mutations in a DNA sequence.  If the original DNA strand is 5'-ATGGGACTAGATACC-3', then which of the following represents a nonsense mutation? (1pt) 5'-ATGGGTCTAGATACC-3' 5'-ATGCGACTAGATACC-3' 5'-ATGTGACTAGATACC-3' 5'-ATGGGACTAAGATACC-3' 2. A mutation that changes a codon sequence, and subsequently changes the amino acid that should have been placed at that point in the polypeptide chain, is called a… (1pt) silent mutation frameshift mutation missense mutation nonsense mutation 3. Excision repair corrects DNA by (1pt) correcting A=T...

  • You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce...

    You examine a bacterial gene that produces a small peptide. The DNA sequence is predi produce the mRNA sequence indicated below (Questions 13-15). cted to 5- UCUUAGGAGGUAUCCAUGUCCGGUACUGCGAGAGGUAGUUAAGCC3 Shine-Dalgarno motif Site of insertion for question 14 13) Predict the amino acid sequence of the peptide produced from this mRNA (use the 3-letter abbreviation for amino acid names; e.g. ILE for isoleucine, ALA for alanine. Look it up online if you can't find it in one of your biology books). 14) What...

  • A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....

    A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...

  • Shown below is the anti-sense DNA sequence from a region of a gene that produces a...

    Shown below is the anti-sense DNA sequence from a region of a gene that produces a specific protein. Mutations in this region of the gene cause a disease CTT TTA TAG TAG ATA CCA CAA AGG a. What is the mRNA strand that is transcribed from the DNA shown above? b. What is the amino acid sequence that would be translated from the mRNA strand you determined in part 1? c. If an individual has a G at position 15...

  • D Question 4 A silent mutation has no change in RNA sequence O no change to...

    D Question 4 A silent mutation has no change in RNA sequence O no change to DNA, RNA, or protein O no change in protein sequence O no change in DNA sequence Question 5 Which mutation changes one amino acid for another? nonsense all of these are correct missense silent

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT