Homework Answers
Non template: 5' CCC ATG TGG CAT GCA ACC ACA CAC GAA CAC GAG TTG ATG AGT TGA 3'
Template DNA 3' GGG TAC ACC GTA CGT TGG TGT GTG CTT GTG CTC AAC TAC TCA ACT 5'
mRNA 5' CCC ATG TGG CAT GCA ACC ACA CAC GAA CAC GAG TTG ATG AGT TGA 3'
Protein : P M W H T T T H E H E L M S ***
Add Answer to:
Use the codon table below to transcribe and translate this message using the one-letter abbreviations for...
(References) Consider the short fragment of DNA below. Using their one-letter abbreviations, and typing with capi...
(References) Consider the short fragment of DNA below. Using their one-letter abbreviations, and typing with capital letters and no spaces, give the corresponding sequence of amino acids. 3' - GCCATTCGTACOTTAGA ATACCTATCCGCGATTA.5 Answer: [References) Consider the short fragment of DNA shown below. Using their one-letter abbreviations, and typing wiht capital letters and no spaces, give the corresponding sequence of amino acids. 3-GGGCTATTATTACACCGGGTATTACCTAACTTAAGCGCGAGCG-5 Answer: (References) Consider the short DNA fragment shown below. Using their one-letter abbreviations, and typing using capital letters with...
Starting with this strand of DNA: 1) transcribe it into mRNA, 2) translate the mRNA into...
Starting with this strand of DNA: 1) transcribe it into mRNA, 2) translate the mRNA into its corresponding protein (USING SINGLE LETTER ABBREVIATIONS of the amino acids), and 3) determine the protein sequence if you had a DELETION mutation of the emboldened thymine. 3’ 5’ TCGGCGTGTACTACTACACGGTATATACGTTTCTTTTGATTAGCCGCTT
EXERCISE Translation What two amino acids have only one codon? Enter their 3 letter abbreviations 2nd...
EXERCISE Translation What two amino acids have only one codon? Enter their 3 letter abbreviations 2nd Mueles de Phe UUU UUC UUA UU Cys ucu UCC UCA UCO UGU UGC UAU UAC WA UA Stop dodon Stop codoh UOO Stop dod TEP CGU Ang CUU CUC CUA CU не His Oin Ag CAU CAC CAA CAC 3 15 Nuolatida COA COG din AUU AUC AUA AUG Initiation Codon ACU ACC ACA Асе UGAGUC6UcAGUCA Nucleotide AAC AAA AAO AGU AOC AGA...
References Consider the short DNA fragment shown below. Using their one-letter abbreviations, and typing using capi...
References Consider the short DNA fragment shown below. Using their one-letter abbreviations, and typing using capital letters with no spaces, give the corresponding sequence of amino acids. 5-GCCAATGCTTAGTATTTACAAATCCTCGTCATTAGCTGGG -3 Answer: Submit Answer Try Another Version 2 Item attempts remaining
Give the amino acid sequence in the following tetrapeptide using both 3-letter and 1-letter abbreviations for the amino acids. (Capitalize amino acid abbreviations appropriately.) ball & stick la...
Give the amino acid sequence in the following tetrapeptide using both 3-letter and 1-letter abbreviations for the amino acids. (Capitalize amino acid abbreviations appropriately.) ball & stick labels Sequence 3-letter abbreviations) (Separate abbreviations with hyphens.) Sequence (1-letter abbreviations) Do not separate abreviations with hyphens.)
Give the amino acid sequence in the following tetrapeptide using both 3-letter and 1-letter abbreviations for the amino acids. (Capitalize amino acid abbreviations appropriately.) ball & stick labels Sequence 3-letter abbreviations) (Separate abbreviations with hyphens.) Sequence...
Transcribe this DNA strand into mRNA and then translate it based on the genetic code below...
Transcribe this DNA strand into mRNA and then translate it based on the genetic code below using the single letter amino acid abbreviation. 3'TATAAATGCTCTACAGTTACTAAAATCTTATTTGAC5'
Please replicate the gene. Then transcribe and translate the sister strand of DNA. Remember to label...
Please replicate the gene. Then transcribe and translate the sister strand of DNA. Remember to label your molecules with the amino and carboxyl groups or the 3' and 5* as needed. 3'-A ATTAGCGATATGTACGCTACCGTACGATTAA-5| Secondliste Tynne UNA Stop codon UAC Stop codon UC Stop codon Third letter Methionines startonden
2. A (1 pt) Using the Genetic Code table, determine the peptide that is encoded by...
2. A (1 pt) Using the Genetic Code table, determine the peptide that is encoded by the part of the mRNA molecule shown. Use the three-letter designation for amino acids. Start with the first start codon the ribosome would translate, and end at a stop codon 5'-CUGCGAUGAUUAGCCUAAUGGUUGAGAGUUGAUAGGCG-3 B. (0.25 pt) If this is a eukaryotic mRNA, would the TATA box present in the full-length transcript?
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC...
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
The image below is a mRNA message. Please draw a ribosome translating the message below. Draw...
The image below is a mRNA message.
Please draw a ribosome translating the message below. Draw the
ribosome with P-site ON CODON 3. In your image draw the ribosome
immediately prior to it translocating to the next codon.
It is important to draw tRNAs, amino
acids, etc in the correct location. Do not forget to label all of
the following: A-site (and tRNA), P-site (and tRNA), E-site (and
tRNA), large subunit, small subunit, all amino acids in their
correct positions...
(References) Consider the short fragment of DNA below. Using their one-letter abbreviations, and typing with capital letters and no spaces, give the corresponding sequence of amino acids. 3' - GCCATTCGTACOTTAGA ATACCTATCCGCGATTA.5 Answer: [References) Consider the short fragment of DNA shown below. Using their one-letter abbreviations, and typing wiht capital letters and no spaces, give the corresponding sequence of amino acids. 3-GGGCTATTATTACACCGGGTATTACCTAACTTAAGCGCGAGCG-5 Answer: (References) Consider the short DNA fragment shown below. Using their one-letter abbreviations, and typing using capital letters with...
EXERCISE Translation What two amino acids have only one codon? Enter their 3 letter abbreviations 2nd Mueles de Phe UUU UUC UUA UU Cys ucu UCC UCA UCO UGU UGC UAU UAC WA UA Stop dodon Stop codoh UOO Stop dod TEP CGU Ang CUU CUC CUA CU не His Oin Ag CAU CAC CAA CAC 3 15 Nuolatida COA COG din AUU AUC AUA AUG Initiation Codon ACU ACC ACA Асе UGAGUC6UcAGUCA Nucleotide AAC AAA AAO AGU AOC AGA...
References Consider the short DNA fragment shown below. Using their one-letter abbreviations, and typing using capital letters with no spaces, give the corresponding sequence of amino acids. 5-GCCAATGCTTAGTATTTACAAATCCTCGTCATTAGCTGGG -3 Answer: Submit Answer Try Another Version 2 Item attempts remaining
Give the amino acid sequence in the following tetrapeptide using both 3-letter and 1-letter abbreviations for the amino acids. (Capitalize amino acid abbreviations appropriately.) ball & stick labels Sequence 3-letter abbreviations) (Separate abbreviations with hyphens.) Sequence (1-letter abbreviations) Do not separate abreviations with hyphens.)
Give the amino acid sequence in the following tetrapeptide using both 3-letter and 1-letter abbreviations for the amino acids. (Capitalize amino acid abbreviations appropriately.) ball & stick labels Sequence 3-letter abbreviations) (Separate abbreviations with hyphens.) Sequence...
Please replicate the gene. Then transcribe and translate the sister strand of DNA. Remember to label your molecules with the amino and carboxyl groups or the 3' and 5* as needed. 3'-A ATTAGCGATATGTACGCTACCGTACGATTAA-5| Secondliste Tynne UNA Stop codon UAC Stop codon UC Stop codon Third letter Methionines startonden
2. A (1 pt) Using the Genetic Code table, determine the peptide that is encoded by the part of the mRNA molecule shown. Use the three-letter designation for amino acids. Start with the first start codon the ribosome would translate, and end at a stop codon 5'-CUGCGAUGAUUAGCCUAAUGGUUGAGAGUUGAUAGGCG-3 B. (0.25 pt) If this is a eukaryotic mRNA, would the TATA box present in the full-length transcript?
15. Transcribe into mRNA and then translate into amino acids (protein) the following DNA sequence TAC ATG TCT AGG ATC. Write out the tRNA anticodons for each of the 5 codons as well. What is the complementary DNA sequence for the above DNA (the complementary sequence would be produced in DNA replication)? Suggested Format: DNA: TAC ATG TCT AGG ATC. Complementary: mRNA based on DNA: TRNAs that would pair with mRNA (the anticodon): Amino Acid Sequence: To transcribe the sequence...
The image below is a mRNA message.
Please draw a ribosome translating the message below. Draw the
ribosome with P-site ON CODON 3. In your image draw the ribosome
immediately prior to it translocating to the next codon.
It is important to draw tRNAs, amino
acids, etc in the correct location. Do not forget to label all of
the following: A-site (and tRNA), P-site (and tRNA), E-site (and
tRNA), large subunit, small subunit, all amino acids in their
correct positions...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago