Question

UUU SI First position (5-end) AUU AUC Third position (3-end) SORO AUA AUG mer GUU GUC GUA CUG initiation Termination Using t
Using the sequences from question 4, what type of mutation gives rise to sequence 2? frameshift nonsense synonymous (silence)
0 0
Add a comment Improve this question Transcribed image text
Request Professional Answer

Request Answer!

We need at least 10 more requests to produce the answer.

0 / 10 have requested this problem solution

The more requests, the faster the answer.

Request! (Login Required)


All students who have requested the answer will be notified once they are available.
Know the answer?
Add Answer to:
UUU SI First position (5-end) AUU AUC Third position (3'-end) SORO AUA AUG mer GUU GUC...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Similar Homework Help Questions
  • If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give...

    If the sequence of an mRNA molecule is: 5' AUG GGA UUU CGA 3' (a) Give the sequence of the template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (b) Give the sequence of the non-template strand of DNA. (Please indicate where the 5' and 3" ends are located) (1.5 marks) (c) Give the amino acid sequence. (1.5 marks) You will require the following genetic code to answer this question. Second letter с...

  • I have the answers to PART I, I need PART II please. PART I 1. Translate...

    I have the answers to PART I, I need PART II please. PART I 1. Translate the following sequence: AUG GAG GUC UUU AAG AGA CAU UUA GAU GUA GCC CUU AGU GAU GUU UAG 2. Create one or more point mutations in this sequence: AUG GAG GUC UUU AAG AGA CAU UUA GAU GUA GCC CUU AGU GAU GUU UAG 3. Translate your mutated sequence. 4. Now, create a frameshift mutation by adding one or more bases. AUG GAG...

  • Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is...

    Describe what kind of mutation this allele has (e.g. insertion, deletion, substitution), which codon it is in, what effect it will have on the protein (e.g. nonsense missense, silent) as well as the amino acid change it will cause if it is a substitution. Refer to the genetic code. U UUU C UCU Uục Phe UCC Ser UUA UUG CUU UCA UCG CCU CCC Α UAU UAC y UGC cys UAA Stop UGA Stop UAG Stop UGG trp CGU CAC"...

  • Use the genetic code table to answer the following question: Second Base First Base Third Base...

    Use the genetic code table to answer the following question: Second Base First Base Third Base UUU UUC Phenylalanine U UCU UAC UCA UCG Serine UUA UUG Leucine UAU UGU UAC Tyrosine UGC Cysteine UAA Stop codon UGA Stop codon UAG Stop codon UGG Tryptophan CAU CGU Histidine CAC CGC Arginine CAG Glutamine CGG CUU CUC CUA CUG Leucine CCU CCC CCA CCG Proline CAA CGA AUU AAU Asparagine AGU Serine AGC AUC AUA Isolaucine ACU ACC ACA ACG AAC...

  • The following genomic DNA sequence comes from the first exon of a human gene and contains...

    The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...

  • 1. The following nucleotide sequence is found on a strand of mRNA. Give the altered amino...

    1. The following nucleotide sequence is found on a strand of mRNA. Give the altered amino acid sequence of the protein that will be found in each of the following mutations. Please also list an anticipated phenotypical change(s) (nonsense, missense, frameshift, addition/subtraction of amino acid etc.) (1 pts each) Second position Nucleotide #: 1 4 7 10 13 U UUU 16 19 22 UCU UAU UGU UUC UAC UAA UUA UUD RNA: 5-AUG ACC GGC AAU CAA CUA UAU UGA-3'...

  • A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3'...

    A single mutation has occurred in the following DNA sequence. 5' ATG AAA TTA CCA 3' wild-type (normal) sequence 5' ATG AAG TTA CCA 3' mutant sequence (a) Identify and classify the mutation according to its molecular structure (i.e., insertion, deletion base substitution (transversion), or base substitution (transition)). Briefly explain why you selected this classification (1.75 marks) (b) Identify and classify the mutation according to its functional effects (i.e., frameshift, missense, nonsense, or silent). Briefly explain why you selected this...

  • Bring this DNA sequence to protein using the transcription (3pts) and translation (4 pts) processes. note:...

    Bring this DNA sequence to protein using the transcription (3pts) and translation (4 pts) processes. note: Pending the direction your DNA is located Second position UUU Ae UCU UCC cys DU Sey UAU UAC UAA UAG UGU UGC UGA UGG UUA tyr Stop Stop JC Stop CUU CUC his CUA 5 'ATGCCGACGCCATAA 3' Lleve esta secuencia de ADN hasta proteína mediante los procesos de transcripción (3pts) y traducción (4 pts). First position (5'-end) CUC AUU AUC ile AUA AUG met...

  • 7. (2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first...

    7. (2 pts) Below is a DNA sequence encoding an mRNA strand. What are the first four amino acids that this sequence codes for? (Not that the coding strand has been labeled). 5'-TACTTCTGGCATATC-3' 3'-ATGAAGACCGTATAG-5' (coding) Second letter C AG UUU Phe UCU) UAU Tyrac Cys UUCS Ser UUG UACJ'Y UAA Stop UGA Stop UAG Stop UGG Trp CGU CAC) CGC CGA CGG CAU-His CUU CUC Leu CUA CUG J Pro CAAG CAGGI First letter DUO DOCUDUCUDUCU Third letter ACU AAU...

  • hi please help. im having trouble with transcribing the given dna fragment! 1. A double stranded...

    hi please help. im having trouble with transcribing the given dna fragment! 1. A double stranded DNA has the following sequence: +1 5' GGCGGCGGCTGCCTATGCTGGCTTCAGCGTAGGCGTAC 3' coding strand TIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII 3' CCGCCGCCGACGGATACGACCGAAGTCGCATCCGCATG 5' A UUU UAUTY ser UCO Stog Transcribe the given DNA fragment (5-GGC GGA UGC CUC GGC UGG CUU AAG CGG AC 5'UTR (highlight in green) Second Letter с 3' UTR (highlight in blue Start Codon (highlight in yellow) VUC ) Stop Codon (highlight in red) Open reading frame (enter...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT