Question

UT EID: D. 5 E. 6 13. For the E. coli strain containing the following alleles of the lac operon, expression of lacZ and lacY is inducible, constitutively on or permanently repressed. (erepressor; r cannot bind operator: osoperator, o cannot bind repressor, lac are LOF mutations) A. lacZ is inducible, lacY is constitutively on. B. lacZ is constitutively on, lacY is inducible. C. lacZ is permanently repressed, lacY is constitutively on. D. lacZ is constitutively on, lacY is permanently repressed. E. Both lacZ and lacY are constitutively on 14. For the E. coli strain containing the following alleles of the trp operon, indicate which trp genes fully constitutive even in the presence of tryptophan. cannot bind operator; o-operator, o (R=repressor, R att=attenuator; att. deletes the attenuator, P=promoter, t pare LOF mutations) cannot bind repressor, A. trpE and trpD B. trpC and trpB C. None of them are fully constitutive. D. All four of them are fully constitutive. 15. How can tryptophan synthesis be blocked even in the absence of tryptophan? A. When you mutate the operator so Trp repressor cannot bind. B. When you mutate the Trp repressor so it cannot bind to the operator nttenuation cannot occur
0 0
Add a comment Improve this question Transcribed image text
Answer #1

13. The answer is B. LacZ gene is constitutively on and lacY is inducible.

The repressor can acts in both cis and transmode. so, the functioal repressor fo second operon acts on first operon also. So, the gene Y is inducible and as the second operon has constitutive operator, the repressor cannnot binds to operator so it expresses continously.

ACCORDING TO CHEGG GUIDELINES WE HAVE TO ANSWER ONE QUESTION AT A TIME. POST THE REST AS SPERATE QUESTIONS, THEN I CAN HELP YOU.

Add a comment
Know the answer?
Add Answer to:
UT EID: D. 5 E. 6 13. For the E. coli strain containing the following alleles...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • help please as soon as possible A mutant E. coli strain is found that does not...

    help please as soon as possible A mutant E. coli strain is found that does not synthesize any enzymes in the presence or absence of lactose (or allolactose). W mutation(s) can lead to this outcome? The lac operon is shown here as a guide. fones where proteins bind DNA genes and regulatory sequences Operator La repressor B-galactosidase B-galactos de transactylase proteins promoter Operator Lacy Lac A laci o Lacz

  • 3. Consider a hypothetical strain of E. coli (strain 401) that contains two mutations that affect...

    3. Consider a hypothetical strain of E. coli (strain 401) that contains two mutations that affect tryptophan biosynthesis. The first mutation is a single nucleotide substitution that converts the second tandem Trp codon in region 1 of the Trp leader sequence into a stop codon (see slides 2-7 of Lecture 24 on iLearn) trp structural genes trpE trpD trpC trpB trpA PO Trp Leader Met-Lys-Ala-lle-Phe-Val-Leu-Lys-Gly-Trp-Trp-Arg-Thr Ser- Stop Assume that strain 401 also contains a mutation in the gene for the...

  • B2. Consider E. coli cells, each having one of the following mutations: a) a mutant lac...

    B2. Consider E. coli cells, each having one of the following mutations: a) a mutant lac operator (Oc locus) that cannot bind repressor. b) a mutant lac repressor (I- gene product) that cannot bind to the lac operator. c) a mutant lac repressor (the Is gene product) that cannot bind to lactose. d) a mutant lac promoter that cannot bind CAP + cAMP. What effect would each mutation have on the function of lac operon (assuming no glucose is present)...

  • 20862a a A mutant E. coli strain is found that does not synthesize any enzymes in...

    20862a a A mutant E. coli strain is found that does not synthesize any enzymes in the presence or absence of lactose for allolactose). What mutation(s) can lead to this outcome? The lac operon is shown here as a guide. ones where proteins bind DNA genes and regulatory sequences och Operator o Lacy o Lacz o Laca promoter MacBook Air * जीप

  • A mutant E. coli strain is found that synthesizes B-galactosidase and permease but no B-galactoside-transacetylase in...

    A mutant E. coli strain is found that synthesizes B-galactosidase and permease but no B-galactoside-transacetylase in the presence of lactose (or allolactose). What mutation(s) can lead to this outcome? The lac operon is shown here as a guide. zones where proteins bind DNA: genes and regulatory sequences I lacl promoter operator lac Z l ac Y La repressor B-galactosidase B-galactoside transacetylase proteins Operator Laci promoter Lac Y Lac A Lacz

  • the answer I gave was wrong A mutant E. coli strain is found that synthesizes B-galactosidase...

    the answer I gave was wrong A mutant E. coli strain is found that synthesizes B-galactosidase whether or not lactose (or allolactose) is present. What mutations can independently lead to this outcome? The lac operon is shown here as a guide. zones where proteins bind DNA: genes and regulatory sequences lac 1 operator promoter -35 lac z lac Y lac A JOSSA expression Lac repressor B-galactosidase B-galactoside- transacetylase proteins permease Lac Z Lac A promoter operator laci Lac Y

  • 4. Monod's group figured out how the different parts of lac operon work by constructing "meroploidl...

    4. Monod's group figured out how the different parts of lac operon work by constructing "meroploidl E. coli cells. These have two copies of each of the lac operon genes, one in their chromosome and one on a plasmid* (actually a separate chromosome fragment introduced via conjugation), so they are "partial diploids." Many different versions of these were constructed, with different combinations of mutations in the chromosomal and/or plasmid- encoded genes. +/- indicate active/inactive gene products. O® = "constitutively active...

  • Yet, all the cells in your body contain the same genes (and same alleles). The difference...

    Yet, all the cells in your body contain the same genes (and same alleles). The difference across cell types is that genes get selectively expressed (turned on or off) based on the proteins needed for cellular function given their environment. Select which statement explains the reason why hair does not normally grow on your muscle cells. a. Muscle cells have the gene for keratin, but do not express it b. Muscle cells do not have the gene for keratin and...

  • 1. What transcript is produced from this gene? 5’ ATTGTGAGCAGGAAGAGAGT 3’ 3’ TAACACTCGTCCTTCTCTCA 5’ A) 5’AUUGUGAGCAGGAAGAGAGU3’...

    1. What transcript is produced from this gene? 5’ ATTGTGAGCAGGAAGAGAGT 3’ 3’ TAACACTCGTCCTTCTCTCA 5’ A) 5’AUUGUGAGCAGGAAGAGAGU3’ B) 5’ACUCUCUUCCUGCUCACAAU3’ C) 5’UAACACUCGUCCUUCUCUCA3’ D) 5’UGAGAGAAGGACGAGUGUUA3’ 2.If the anticodon is 5’CAU 3’, what codon on the mRNA will it bind? 3.The lac operon is ON in which situation: A) Low glucose low lactose B) Low glucose high lactose C) High glucose high lactose D) High glucose low lactose 4.You have isolated an E. coli mutant that has a deletion of the gene encoding the...

  • QUESTION 8 The following situations (1-4) involve different types of gene regulation in prokaryotic cells as shown. OFF...

    QUESTION 8 The following situations (1-4) involve different types of gene regulation in prokaryotic cells as shown. OFF and ON reter to whether the gene is transcribed or not. Draw clearly-labelled regulatory proteins and effector molecules in each diagram to explain how the regulation works in each case. The first one has been done for you as an example a) (6 marks) Type of Regulation Regulatory protein effector molecule 1 DNA X negative inducible OFF ON 2 negative repressible DNA...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT