Question

ure March, 24 Name: Lab Section: MoBio Chapter 7 Problem Set Homework Assignment #3 Final Cone n.a. 1. Caleulate how to setup a Restriction Enzyme Digestion as indieted below: STOCK Volume to Pipet Water (Sterile, PCR Quality) 10 X Enzyme Digestion Buffer DNA Sample @500 ng/ul Eco RI Enzyme @ 20 units/ul. units total FINAL VOL- 20 ul. 1 ug total TYPE OR ATTACH HERE, your answers to Textbook Chapt7 Problems #2. 4, 9, 12, 13, 18, 19 Notes: For Extra Credit Pts (4), for problem #9, indicate on the sequence below, the position of the primer annealing (arrowhead representing 3' end of 25 nt primer) that would be required to get spesifieannealing. Think about problems annealing specifically to a repeated sequence. (Show just the arrowheads on this sequence; the primer can extend out beyond the sequence shown here) 307 ATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCTCAAGTCCTTC 1 MAT L E K L M KAFESLK F 358 CAGCAGTTCCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG 18 QQFQQQQQQQQQQQQQQ 409 CAGCAGCAGCAGCAGCAGCAGCAACAGCCGCCACCGCCGCCCCCCCCCCCG 35 QQQQQQQQQ P P P P P P P P 460 CCGCCTCCTCAGCTTCCTCAGCCACCOCCO 52 P P P Q L P Q PPP

Answer 1

We need to prepare 1X concentration from 10X buffer. Total volume is 20 µl.

So, N₁V₁ = N₂V₂

V1 = 20*1/10 = 2 µl

Volume of 10X buffer need to be added is 2µl.

We have 500 ng in 1 µl. Required is 1 µg. So, 2µl of DNA sample volume is needed.

We have 20 units restriction enzyme per µl and we need 20 units. So, required enzyme volume is 1 µl

Rest of the volume is water = total volume – volume of 10X buffer to be added – volume of DNA sample to be added – volume of enzyme to be added

Then, volume of water to pipet = 20-2-2-1 =15 µl of water