a) is the right option. This mutation is a nonsense mutation type. In the mRNA 5'UAC3' codes for tyrosine amino acid which anticodon in tRNA is 5'GUA3'. Due to nonsense mutation tRNA anticodon 5'GUA3' change to 5'UAA3' which are stop codon. So, when mRNA comes to pair with tRNA anticodon it read as stop codon and translation gets to stop. In the nonsense mutation a truncated, incomplete, and usually nonfunctional protein product form.
QUESTION 34 The gene encoding an E. coli tRNA containing the anticodon 5'-GUA-3' mutates so that...
In the diagram below find • 1. mRNA • 2. tRNA . 3. polypeptide B С A D PA MANGAN Start codon Stop codon In the following diagram of translation find: 4. 30S ribosomal subunit 5. RNA 6. mRNA 7. Amino acid 8. A site 9. Anticodon 10. Start codon A G D H AUG E B
What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND POSITION с A U phenyl- alanine tyrosine cysteine U serine U с A leucine stop stop tryptophan stop G histidine U с A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G U isoleucine asparagine serine A threonine A lysine arginine methionine G U с A valine G aspartic acid glutamic acid alanine glycine and start Cysteine Alanine Arginine Serine
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
QUESTION 6 The DNA sense (coding) strand for a particular amino acid is 5'-CAT-3'. What RNA sequence would be transcribed for this codon, what tRNA anticodon would recognize it, and what amino acid would be added in response to this codon? O 5'-UUU-3' (RNA sense); 3'-AAA-5' (tRNA anticodon); phenylalanine O 5'-CAU-3' (RNA sense); 3'-GUA-5' (tRNA anticodon); histidine O 5'-CAU-3' (RNA sense); 3'-AUG-5’ (tRNA anticodon); tyrosine O 3'-AUG-5' (RNA sense); 3'-UAC-5' (TRNA anticodon); valine QUESTION 7 The “wobble” base is less...
50 LAB 2 Genetics EXERCISE 10 PROTEIN SYNTHESIS Work with a partner to complete this exercise and answer the questions that follow. You will use the DNA strand from Exercise to make the protein for which it codes STEP 1 Review the imaginary strand of DNA below. Note the complementary base pairs. AGCAATCCGTCTTGG TCGTTAGG CAGAACC STEP 2 Draw the DNA strand separating down the middle las in the beginning of DNA replication STEP 3 Draw the free-floating RNA bases linking...
A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...
Question 24 Refer to the table below to answer the following question. А G U Serine Serine Serine U с A UAA U с А с w Phenylalanine UCU UUC Phenylalanine UCC UUA Leucine UCA UUG Leucine UCG CUU Leucine CCU CUC Leucine сос CUA Leucine CCA CUG Leucine CCG Isoleucine ACU AUC Isoleucine ACC AUA Isoleucine ACA AUG Methionine Start ACG GUU Valine GCU GUC Valine GCC GUA Valine GCA GUG Valine GCG UAU Tyrosine UAC Tyrosine Stop UAG...
This DNA sequence comes from part of a gene on a chromosome of a eukaryotic organism. i) If the bottom strand of the sequence is the template strand and the top strand is the coding strand, circle the answer below that best represents the direction that RNA polymerase would move along the template DNA strand. Left to Right Right to Left Lagging to Leading A site to P site ii) Given the information in 6 i, write the sequence of the mRNA...
UUU SI First position (5-end) AUU AUC Third position (3'-end) SORO AUA AUG mer GUU GUC GUA CUG initiation Termination Using the coding dictionary above, predict the amino acid sequence produced during translation by the following short hypothetical mRNA sequence (note that the second sequence was formed from the first by a deletion of only one nucleotide). Type only the amino acid sequence separated by (-) with no spaces, including the stop codon by typing stop. N and C terminus...
Hello please please help !! Thank you!!
Please and thank you soo
much!!!
Question Completion Status: Question 10: The genetic code consists of 64 triplets of nucleotides (called codons). Each codon (with the exception of the 3 stop codons) encodes for one of the 20 amino acids used in the synthesis of proteins. This produces some redundancy in the code as most amino acids are encoded by more than one codon. One codon, AUG serves two related functions: it signals...