Question

Point mutations-nucleotide substitutions o Show what would happen if 3. codon #2 in previous DNA sequence got changed to ACA
o Use this sequence of nucleotides (DNA): 3TACACGGCCCTTGGAAAACACACT5 1. Transcribe the DNA 2. Translate the DNA using geneti
0 0
Add a comment Improve this question Transcribed image text
Answer #1

3. When codon #2 s changed from ACG to ACA a pont mutation is done. But it will not bring any change in the amino acid it codes for. Because ACG codes for the mRNA codon UGC and ACA codes for UGU. Both of them codes for the same amino acid Cystein.

4. When codon #2 is changed to ACC it will bring the change in the amino acid coded. The mRNA codon changed from UGC to UGG, which codes for the amino acid Tryptophan. Here the Cystein is changed to Tryptophan.

5. When the codon #2 is changed to ACT, it will terminate the translation process. This is because ACT triplet codon codes for the UGA mRNA codon which is one among the stop codons.

Each of the above mutation changes the triplet codons. Except the mutation in #3, other two (#4 & #5) bring a change to the amino acid it codes for. No change in amino acid in the mutation #3 , because here ACG is changed to ACA. Both these codons codes for the same amino acid Cystein. But when the codon is changed to ACC ( mutation #4), the mRNA codon changed to UGG which codes a different amino acid , Tryptophan. The mutation #5 will cause the termination in translation process. This is because, ACT codon has the mRNA codon UGA, which is one among the three stop codons. It will stop the translation process.

1. Sequence of nucleotides (DNA)- 3'TACACGGCCCTTGGAAAACACACT5'

Transcript will be complimentary to the given sequence. Uracil will be added in complimentary to Adenine in RNA.

mRNA transcript from the given DNA sequence is- 5'AUGUGCCGGGAACCUUUUGUGUGA3'

2. Translated DNA -- N- methionine-cystein-arginine-glutamate-proline-phenylalanine-valine-C

5' end of the mRNA corresponds to N-terminus in translate and the 3' end of mRNA is the C- terminus of translate. The last codon UGA is a stop codon. So, translation stops with terminal Valine.

Add a comment
Know the answer?
Add Answer to:
Point mutations-nucleotide substitutions o Show what would happen if 3. codon #2 in previous DNA sequence...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • “translate” the following DNA nucleotide sequence into the amino acids that would be produced from this...

    “translate” the following DNA nucleotide sequence into the amino acids that would be produced from this sequence. Hint 1 – DNA must first be transcribed into messenger RNA. Hint 2 – Your ANSWER will be written in amino acids not nucleotides! TAC AAT ACA ACT

  • 1. You have used a mutagen to induce mutations in a DNA sequence.  If the original DNA...

    1. You have used a mutagen to induce mutations in a DNA sequence.  If the original DNA strand is 5'-ATGGGACTAGATACC-3', then which of the following represents a nonsense mutation? (1pt) 5'-ATGGGTCTAGATACC-3' 5'-ATGCGACTAGATACC-3' 5'-ATGTGACTAGATACC-3' 5'-ATGGGACTAAGATACC-3' 2. A mutation that changes a codon sequence, and subsequently changes the amino acid that should have been placed at that point in the polypeptide chain, is called a… (1pt) silent mutation frameshift mutation missense mutation nonsense mutation 3. Excision repair corrects DNA by (1pt) correcting A=T...

  • A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA....

    A mutation is a permanent change in the sequence of nucleotide bases in a cell's DNA. Most mutations happen during DNA replication, but their effects are not seen until transcription and translation. Even a small mutation that changes a single nucleotide can have a major impact on the resulting proteins that are made in the cell. с The table following the amino acid chart lists a segment of a normal gene. Type in the corresponding mRNA strand and the amino...

  • QUESTION 3 The codon S-AUG-3' on an mRNA encodes the amino acid methionine. What is the...

    QUESTION 3 The codon S-AUG-3' on an mRNA encodes the amino acid methionine. What is the corresponding anticodon found on the methionine charged tRNA? 3-UAC-5 5-UAC-3 o 3-GUA-5 5'-ATG-3 QUESTION 4 Match each cause of DNA damage with the mechanism by which it can lead to mutations. Topoisomerase is unable to function properly, and when it makes A cuts in the DNA strands these are not always repaired. This leads to a loss of nucleotides and potential frameshift mutations. In...

  • Overview The purpose of this activity is to help the students to understand how replication, tran...

    TranslationOverview:The purpose of this activity is to help the students to understand how replication, transcription, and translation are connected. Students will use a sequence from a bacterial gene that confers resistance to antibiotics (carbapenems). They will be asked to apply the knowledge obtained in the class lecture to (1) find the promoter in the sequence, (2) determine the amino acid sequence of a fragment of the polypeptide, (3) "reverse translate" a fragment of the polypeptide, and (4) identify mutations in...

  • Complete the following table and answer the next two questions (3.5 marts) 10 B I =...

    Complete the following table and answer the next two questions (3.5 marts) 10 B I = U Ꭶ X2 x E I 19 эс ✓ C Finis DNA strand G C А DNA strand TAC TAC mRNA codon AUG C G G tRNA anticodon G - Amino acid Tryptophan Stop mRNA and tRNA are involved in producing proteins from genes in the DNA. One codon consisting of 3 nucleotides corresponds to an amino acid in the protein that gets built...

  • 21-1114 Date Transcription Kit Checklist Part 1: Making mRNA 1. Parts of a nucleotide: Approved Sugar...

    21-1114 Date Transcription Kit Checklist Part 1: Making mRNA 1. Parts of a nucleotide: Approved Sugar Phosphate Bases: Adenine Guanine Cytosine Uracil 2. One nucleotide Note: Omit 3-6 if not using the DNA Structure and Function Kit. 3. Separated DNA 4. Template DNA with one complementary nucleotide of RNA hydrogen bonded 5. Template DNA with strand of mRNA hydrogen bonded 6. Separated mRNA and duplex DNA molecule 7. Completed mRNA with cap and tail 8. The cap 9. The tail...

  • Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete th...

    Please help with 4-10! DNA, Genes,and Protein Synthesis Activity 13: 2. The bases that interact with each other are called complementary bases. this definition and your answers to 1 complete the following: a. Thiamine (T) is the complementary base of b. Cytosine (C) is the complementary base of c. Adenine (A) is the complementary base of d. Guanine (G) is the complementary base of Based on 3. Shown below is the nucleotide sequence for one strand of a stretch of...

  • Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...

    Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...

  • 1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2....

    1. Use the provided DNA template to synthesize a complementary strand. (1 point)5’ ATGCGTATACGTTCCGTCGCCTAA 3’ 2. What enzyme facilitates the complementary base pairing used to make the complementary strand in question #1. 3. At what site on the DNA molecule does transcription initiate? At what site on the DNA does transcription terminate? 4. Use the DNA molecule from question #1 and transcribe an mRNA molecule. Show the nucleotide sequence of the mRNA molecule. 5. What enzyme is responsible for transcription?...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT