In RNA interference studies, the double-stranded RNA
Select one:
a. disrupts the target DNA sequence
b. results in the destruction of the target mRNA
c. destroys the target protein
d.
all of the above
Hint: it's not D
b. results in the destruction of the target mRNA.
The sequence of events is as follows:
1. The double stranded RNA is broken down into short RNAs.
2. These short RNA activate ribonuclease.
3. These ribonuclease then target homologous mRNA and degrade them.
In RNA interference studies, the double-stranded RNA Select one: a. disrupts the target DNA sequence b....
i) Given the mRNA sequence UCAGAUCCU, write the double-stranded DNA sequence that would have produced this m-RNA sequence. ii) Indicate which strand of DNA is actually used as a template for the synthesis of the mRNA. iii) Show the amino acid sequence that would be expected from this mRNA.
Part A Outline the roles of
double-stranded RNA (dsRNA) in eukaryotic gene regulation. Select
all that apply.
Part A Outline the roles of double-stranded RNA (dsRNA) in eukaryotic gene regulation Select all that apply. O dsRNA can inhibit gene expression by inhibition of transcription through heterochromatin formation. O dsRNA can inhibit gene expression by inhibition of transcription through inhibitor synthesis. O dsRNA can inhibit gene expression by destruction of mRNA. O dsRNA can inhibit gene expression by inhibition of replication....
Why is transcription referred to ”DNA-Directed RNA synthesis”? A. The RNA sequence directs the synthesis of the template DNA strand. B. The sequence of the RNA strand is transferred to the DNA. C. RNA is synthesized using a template DNA strand. D. A double stranded RNA is synthesized using a single stranded RNA.
The following double stranded segment of DNA is part of a protein coding gene. The segments in uppercase letters (ACTG) represent the exons. The segments in lowercase letters (acgt) represent introns. The lower strand is the template strand that is used by the RNA polymerase to make an RNA transcript. GCTAAATGGCAaaattgccggatgacGCACATTGACTCG Gaatcga GGTCAGATGC CGATTTACCGTtttaacggcctact CGTGTA ACTGAGCCttagctCCAGTCTACG write-out: The sequence of the primary transcript: The mature mRNA resulting from this stretch of DNA:
In the first stage of RNA interference, a __________ RNA precursor is cleaved by the _________ enzyme. The cleaved molecules are approximately _________ (insert number) bases in length and are called ___RNA if the RNA originated from a virus or ___RNA if the RNA was of endogenous origin ( if the RNA precursor was produced artificially, it's called ___RNA. The cleaved RNA is then separated into _____________ RNA, which then binds to the ribonuclease complex called __________. The short RNA...
Below is the double-stranded DNA sequence of part of a hypothetical yeast genome, which happens to contain a very small gene. Transcription starts at the Transcription Start Site (TSS) after the promoter (shown in yellow), and proceeds in the direction of the arrow. Transcription stops at the end of the Transcription Terminator (shown in blue). 5' GTATAAATCCCTATGTTGACTTCAAAGGGCCCATGGAAGGGCTGATTCCTAAGA 3' 3' CATATTTAGGGATACAACTGAAGTTTCCCGGGTACCTTCCCGACTAAGGATTCT 5' a) Which strand of DNA shown, the top or the bottom, is the template strand? b) What is the...
Only one strand of a double stranded DNA fragment is shown below. This DNA encodes a beginning of a polypeptide. GTGATGCGGCGCGCGCCACCACATGTGAAAAAATAACTCCGGCATTACGAACCTCGAAGAATCGGGATTTAGCCATTATAGCTAGCC 1. Write down the sequence of mRNA which will be transcribed from this DNA. Hint: it is impossible to identify the first base of a mRNA accurately from just sequence analysis, therefore, chose the first base within plus-minus 2 bp from a real start. (10 points) ABC 2. Write the N-terminal portion of polypeptide which is encoded by this...
1.) An RNA molecule has the following percentrages of bases A = 27% , U=38% , C=20% , G= 15% a. Is this RNA molecules single stranded or double stranded? How Cant you tell? b. What would be the percentage of each of the bases in the template strand of the DNA that contains the genes for this RNA? 2.) Given the following DNA 5' ATG GCG AGG CGG CAGCTGTTATGGTGA - 3' a. What is the transcript (mRNA) sequence? b....
.Select the probe sequence that will hybridize to the following nucleic acid sequence: C G A T A T T G T C A. T A G T A C A A G A B. C G A T A T T G T C C. G T C A A G A C C T D G C T A T A A C A G Select the strand of RNA that is complementary to this single strand of...
The partial sequence of one strand of a double stranded DNA molecule is: 5’ ---GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG--- 3’ Write the sequence of both strands of the DNA fragment when this DNA is cleaved with both EcoRI and PstI. The top of your duplex DNA fragment should be derived from the standard sequence given above.