Is the genetic code universal? State YES or NO. What is the significance of the genetic...
Is the genetic code universal? State YES or NO. What is the significance of the genetic code?
Homework Answers
Add Answer to:
Is the genetic code universal? State YES or NO. What is the
significance of the genetic...
Which of these is not a good descriptor for the genetic code? Nearly Universal Unambiguous Conservative...
Which of these is not a good descriptor for the genetic code? Nearly Universal Unambiguous Conservative Redundant Replicable
1. Anticodon: 3' U A I 5' Could this tRNA conform to the nearly universal genetic...
1. Anticodon: 3' U A I 5' Could this tRNA conform to the nearly universal genetic code? Yes or no
3. Since the genetic code is universal*, different organisms will all “read (transcribe + translate)” the...
3. Since the genetic code is universal*, different organisms will all “read (transcribe + translate)” the same gene sequence the same way. Recombinant DNA technology takes advantage of this by artificially transferring DNA from one organism to another. Give one example of this that would be useful (could be for medicinal purposes, industry, agriculture, etc.)
2 points Which of the statements below is false? * O The genetic code is universal....
2 points Which of the statements below is false? * O The genetic code is universal. Degenerate codons specify the same amino acids. The genetic code is overlapping. O The genetic code is triplet. 2 points How many hydrogen bonds does cytosine form with guanine? * 2 3 O 4 2 points The amino acid sequence of a polypeptide chain comprises the structure of the protein. * primary secondary tertiary O quaternary 2 points One gene can have multiple effects...
Genetic Code The genetic code is what allows the string of nucleotides in our DNA to...
Genetic Code The genetic code is what allows the string of nucleotides in our DNA to code for the sequence of amino acids that make up proteins. Briefly explain what this genetic code is in general and how it works. What is meant by the universality of the genetic code? Explain briefly what the advantages and disadvantages of this type of genetic code are to humans. ANSWER MUST BE ORIGINAL AND NO PLAGIARISM
The genetic code is said to be degenerate. If the genetic code were not degenerate, what...
The genetic code is said to be degenerate. If the genetic code were not degenerate, what would the genetic codon table look like? Explain.
1) The universal genetic code is used to translate aminoacids from a. codons in the DNA...
1) The universal genetic code is used to translate aminoacids from a. codons in the DNA b. codons in the mRNA c. codons in tRNA d. codons in rRNA 2) In RNA, introns are: a. nucleotide sections that do not code for proteins and are not removed before translation b. nucleotide sections that code for proteins and must be removed before transcription c. nucleotide sections that do not code for proteins and must be removed before translation d. nucleotide sections...
60. _A_The genetic code is A. almost universal B. redundant C. ambiguous D. all of the...
60. _A_The genetic code is A. almost universal B. redundant C. ambiguous D. all of the above E. A and B only 61. Which of these is not a step in pre-mRNA processing? A. Exons are removed and introns are spliced together. B. A modified guanine nucleoside is attached to the 3 phosphates at the 5' end. C. 100-250 adenine nucleotides are added to the 3' end. D. Alternative processing involves the removal of different segments of RNA. E. Spliceosomes,...
1. What is the protein synthesized from the genetic code? 2. Does the genetic code have...
1. What is the protein synthesized from the genetic code? 2. Does the genetic code have a 3' untranslated region? Where is it in the sequence? This sequence is the coding strand. 1st bracket = promoter, 2nd bracket = 5' untranslated region [ ATGTATTCCAATGTGATAGGAACTGTAACCTCTGGAAAAGGAAGGTT] [CTTCCTTGGAGACAAATCCCTTACCTTCAATGGACARCAGTGAG] TGGAATGTATATGGAGCCAAGCTCCAGCCCCTGAACTTCAAGGAAAATG
pour Paragraph 60. The genetic code is A. almost universal B. redundant C. ambiguous D. all...
pour Paragraph 60. The genetic code is A. almost universal B. redundant C. ambiguous D. all of the above E. A and B only 61.__Which of these is not a step in pre-mRNA processing? A. Exons are removed and introns are spliced together. B. A modified guanine nucleoside is attached to the 3 phosphates at the 5' end. C. 100-250 adenine nucleotides are added to the 3' end. D. Alternative processing involves the removal of different segments of RNA. E....
2 points Which of the statements below is false? * O The genetic code is universal. Degenerate codons specify the same amino acids. The genetic code is overlapping. O The genetic code is triplet. 2 points How many hydrogen bonds does cytosine form with guanine? * 2 3 O 4 2 points The amino acid sequence of a polypeptide chain comprises the structure of the protein. * primary secondary tertiary O quaternary 2 points One gene can have multiple effects...
60. _A_The genetic code is A. almost universal B. redundant C. ambiguous D. all of the above E. A and B only 61. Which of these is not a step in pre-mRNA processing? A. Exons are removed and introns are spliced together. B. A modified guanine nucleoside is attached to the 3 phosphates at the 5' end. C. 100-250 adenine nucleotides are added to the 3' end. D. Alternative processing involves the removal of different segments of RNA. E. Spliceosomes,...
pour Paragraph 60. The genetic code is A. almost universal B. redundant C. ambiguous D. all of the above E. A and B only 61.__Which of these is not a step in pre-mRNA processing? A. Exons are removed and introns are spliced together. B. A modified guanine nucleoside is attached to the 3 phosphates at the 5' end. C. 100-250 adenine nucleotides are added to the 3' end. D. Alternative processing involves the removal of different segments of RNA. E....
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago