How do the -10 and -35 consensus sequences in the bacteria promoter relate to evolution? A...
How do the -10 and -35 consensus sequences in the bacteria promoter relate to evolution?
A mutation in the -10 (Pribnow) consensus sequence would have what affect?
Homework Answers
Answer=In bacteria -10 and -35 consensus sequences are evolutionary conserved sequences.Few changes occurs in these sequences will affect the transcription that's why these sequences are evolutionary conserved.The Gap between -10 and -35 consensus sequences provides geometrical binding of RNA polymerase and this critical gap also minimize the mutation effect so that's why nature select them.
If mutation occurs in the -10(Pribnow) consensus sequence then sigma factor don't recognise Pribnow consensus sequence and RNA polymerase proper positioning not occur so transcription not proceed or abortive transcription occurs.
Add Answer to:
How do the -10 and -35 consensus sequences in the bacteria
promoter relate to evolution?
A...
Consensus sequences that are involved in prokaryotic/bacterial transcription include... A. the -10 consensus sequence or Pribnow...
Consensus sequences that are involved in prokaryotic/bacterial transcription include... A. the -10 consensus sequence or Pribnow box. B. the -35 consensus sequence. C. enahancer sequences. D. Two of the above. E. All of the above.
Below is the sequence of a synthetic promoter called J23114 that functions with low efficiency in...
Below is the sequence of a synthetic promoter called J23114 that functions with low efficiency in E. coli. The start site for transcription (+1) is the underlined C. TTTATGGCTAGCTCAGTCCTAGGTACAATGCTAGC 1. The six-base-35 and -10 regions are highlight in the promoter. What is the consensus sequence for these two regions? Indicate how many mismatched bases J23114 has for each. -35 consensus sequence = Number of mismatches: -10 consensus sequence = Number of mismatches: 2. What are the functions of the -35...
6. How is transcription initiated and terminated? What is the importance of the promoter consensus sequence?...
6. How is transcription initiated and terminated? What is the importance of the promoter consensus sequence? 7. How are mRNAs modified in eukaryotes? What types of elements are sometimes present in RNA's but 8. What is the genetic code? What are the properties of the triplet codons? What does it mean that the code is How and why do consensus sequences differ from one another? usually not in DNA's? redundant and what useful purpose does such redundancy serve?
Given the following sequences for the bacterial promoter -10 region; TAGGACT TCGCAGA AAGCTTG TACCAAG TTCCTCG a....
Given the following sequences for the bacterial promoter -10 region; TAGGACT TCGCAGA AAGCTTG TACCAAG TTCCTCG a. Determine the consensus sequence b. Design an experiment to support the consensus sequence c. Show the predicted results of your experiment
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase...
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...
Look at the sequences in the figure. They all represent different bacterial promoter regions. Which of...
Look at the sequences in the figure. They all represent different bacterial promoter regions. Which of the sequences listed below is the best consensus sequence for the-35 region based on these seven promoters? -35 sequence -10 sequence loc operon TTTACAN, TATGIT NG loc! GCGCAA N CATGAT NYA trp operon TTGACA N TTAACT NyA τηX TTGTCT NE TAATAT N, A recA TTGATAN TATAAT NA lex TTCCAA NG TATACINE RNA ITTACANTATGATN TRNAV TITACA N, TATGAT N, А Multiple Choice o TTGCAA o...
How does lateral DNA transfer affect the evolution of bacteria? How does lateral transfer compare to...
How does lateral DNA transfer affect the evolution of bacteria? How does lateral transfer compare to mutation as an agent of evolution? simple typed response
Copy of Shown below is a plasmid containing several labeled sequences. Multi-cloning site (CS) Transcription terminator...
Copy of Shown below is a plasmid containing several labeled sequences. Multi-cloning site (CS) Transcription terminator Promoter TATA box original replication a) Based on the sequences it contains, is this plasmid intended for gene expression in eukaryotes or prokaryotes? How do you know? (3 pts) b) Based on your answer to part A, describe the promoter & terminator regions in a little more detail. What is a consensus sequence you would expect in the promoter? And what sorts of sequences...
3. If each sigma factor recognizes a different promoter consensus sequence, how does the cell transcribe...
3. If each sigma factor recognizes a different promoter consensus sequence, how does the cell transcribe a gene that responds to multiple conditions, where each condition utilizes a different sigma factor? What would happen to overall gene expression profiles if RpoS were artificially overexpressed and why?
Describe how to control transcriptional initiation occurs in both PROKARYOTES and EUKARYOTES. Word bank: promoter TATA-Binding...
Describe how to control transcriptional initiation occurs in both PROKARYOTES and EUKARYOTES. Word bank: promoter TATA-Binding Protein (TBP) RNA polymerase + sigma factor enhancer TATA-box gene-specific transcription factors RNA polymerase + GTFs phosphodiester bonds -10 and -35 consensus sequences mediator protein +1 Transcriptional Start Site (TSS) deoxynucleoside triphosphates (dNTPs) template DNA RNA transcript.
Below is the sequence of a synthetic promoter called J23114 that functions with low efficiency in E. coli. The start site for transcription (+1) is the underlined C. TTTATGGCTAGCTCAGTCCTAGGTACAATGCTAGC 1. The six-base-35 and -10 regions are highlight in the promoter. What is the consensus sequence for these two regions? Indicate how many mismatched bases J23114 has for each. -35 consensus sequence = Number of mismatches: -10 consensus sequence = Number of mismatches: 2. What are the functions of the -35...
6. How is transcription initiated and terminated? What is the importance of the promoter consensus sequence? 7. How are mRNAs modified in eukaryotes? What types of elements are sometimes present in RNA's but 8. What is the genetic code? What are the properties of the triplet codons? What does it mean that the code is How and why do consensus sequences differ from one another? usually not in DNA's? redundant and what useful purpose does such redundancy serve?
4. A promoter for an E. coli gene that is transcribed by a s-70 RNA polymerase has the following sequence: 30 -20 10 +1 5'GGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGA 3'CCGAAATGTGAAATACGAAGGCCGAGCATACAACACACCT The transcription start site +1) is identified. a. Identify the -10 and -35 sequences. How close are they to the consensus-10 and-35 sequences? b. What is the spacing between the -10 and the -35 sequences? How does this compare with the consensus spacing? C. The sequence of bases in a transcribed RNA is identical...
Look at the sequences in the figure. They all represent different bacterial promoter regions. Which of the sequences listed below is the best consensus sequence for the-35 region based on these seven promoters? -35 sequence -10 sequence loc operon TTTACAN, TATGIT NG loc! GCGCAA N CATGAT NYA trp operon TTGACA N TTAACT NyA τηX TTGTCT NE TAATAT N, A recA TTGATAN TATAAT NA lex TTCCAA NG TATACINE RNA ITTACANTATGATN TRNAV TITACA N, TATGAT N, А Multiple Choice o TTGCAA o...
Copy of Shown below is a plasmid containing several labeled sequences. Multi-cloning site (CS) Transcription terminator Promoter TATA box original replication a) Based on the sequences it contains, is this plasmid intended for gene expression in eukaryotes or prokaryotes? How do you know? (3 pts) b) Based on your answer to part A, describe the promoter & terminator regions in a little more detail. What is a consensus sequence you would expect in the promoter? And what sorts of sequences...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago