Consider a hypothetical population with two genes. Each of these two genes have two alleles (A & a, B & b). These genes are not linked, and these genes are true dominant/recessive (i.e. not co-dominant or incomplete dominance... "A" dominant to "a" and "B" dominant to "b"). Suppose you perform a monohybrid cross of an AABB homozygote with an aabb homozygote through to the F2 generation. In 2019, the genotype frequency of individuals with "aa" (regardless of their B/b genes) was at 0.09 and the population reproduces once per year. If in 2020, there are 40 heterozygotes (Aa genotypes) out of a total population of 80 individuals, what can we say?
Group of answer choices
A) The population didn't evolve
B) The population evolved via gene flow
C) The population evolved via genetic drift
D) The population evolved, but we can't say why
D. Population evolved, but we can't say why.
This is the right option.
In 2019, aa frequency (q^2) is 0.09.
q = square root of 0.09 = 0.3
As per Hardy -Weinberg equation-- p = q = 1
So, p = 1- q = 1- 0.3 = 0.7
Heterozygote frequency ( 2pq ) in 2019 is --- 0. 3 x 0.7 x 2 = 0.42
In 2020 heterozygote frequency is = heterozygotes number / total offspring
2 pq = 40 / 80 = 0. 5
In 2019 the heterozygote frequency is 0.42 and in 2020, heterozygote frequency is 0.5.
Change in allele frequency is evolution. So in this population , evolution is occurring. But why it is occurring is not known.
Consider a hypothetical population with two genes. Each of these two genes have two alleles (A...
Consider again the hypothetical population with two genes, each with two alleles (A & a, B & b) as in question 6. If you perform a monohybrid cross of an AABB homozygote with an aabb homozygote, what is the proportion of F2 offspring that have the genotype AaBb? a.0.0625 b.0.125 c.0.5 d.0.25
Consider again the hypothetical population with two genes, each with two alleles (A & a, B & b) as in questions 6 & 7. Suppose in 2019, that the genotype frequency of individuals with "aa" (regardless of their B/b genes) was at 0.09. What is the frequency of the "A"allele in this population? a.0.42 b.0.7 c.0.16 d.0.91
Consider a locus of interest that has two alleles: A and a. A diploid individual carrying these alleles can have one of three genotypes: AA, Aa, or aa; a population will consist of some combination of AA, Aa, and aa individuals. The relatively frequency of each of these genotypes makes up the population's structure. Hardy and Weinberg independently figured out that, in the absence of forces that cause evolutionary change, the population structure will 'settle' or default to equilibrium values,...
Consider a locus with two alleles - A and a. These alleles are codominant, meaning that the fitness of the heterozygote is halfway between either homozygote. Consider further a population of randomly mating green frogs where the genotype counts are AA = 500, Aa = 250, and aa = 250. In this population the relative fitnesses of each genotype are AA = 1.00, Aa = 0.80, and aa = 0.60. What is the mean relative fitness within this population? Please...
Consider a locus with two alleles - A and a. These alleles are codominant, meaning that the fitness of the heterozygote is halfway between either homozygote. Consider further a population of randomly mating green frogs where the genotype counts are AA = 500, Aa = 250, and aa = 250. In this population the relative fitnesses of each genotype are AA = 1.00, Aa = 0.80, and aa = 0.60. What is the mean realtive fitness within this population? Please...
Question 1 Which of the following is NOT true regarding Hardy-Weinberg equilibrium (HWE)? Most real species will not be at HWE at all loci within their genome If a locus has genotype frequencies consistent with HWE, then the species as a whole is not evolving If a locus has genotype frequencies consistent with HWE, then no evolution is occurring at that locus If a locus does NOT have genotype frequencies consistent with HWE, then some form of evolution is occurring at that locus Question 2 Which of...
Please submit a word file with your answers to the following questions: 1. Find and copy a link that could help you translate DNA codons to amino acids. 2. Write the DNA codons and below this the amino acids that correspond to the codons: AUGUCUCUCACCAACAAGAACGUC 3. For a population with 200 individuals of "AA" genotype, 200 individuals of "Aa" genotype and 600 individuals of "aa" genotype calculate a. f(A) = p = ? b. and f(a) = q =?, c....
07.900 Thi 3. Le 1. You have sampled a population in which you know that the percentage of the homove recessive genotype(a) is 36%. Using that 36%, calculate the following: A. The frequency of the "sa" genotype. B. The frequency of the altele. 80 C. The frequency of the "A"allele. D. The frequencies of the genotypes "A" and "Aa." 3-12ft ocity of the The frequencies of the two possible phenotypes if 'Ais completely dominant over "a. opactisol the derivatives in...
1.)If the population frequencies of two alleles at a locus are B = 0.5 and b = 0.5, what is onepossible set of frequencies for the three resulting genotypes that would NOT reflect Hardy- Weinberg equilibrium? 2.)In a population that is in Hardy-Weinberg equilibrium, the frequency of the homozygous recessive genotype is 0.09. What is the frequency of individuals that are homozygous for the dominant allele? 3.)In humans, Rh-positive individuals have the Rh antigen on their red blood cells, while...
1. Fixation of Dominant Alleles Start with a population that has a gene with two alleles (A and a) with classical Mendelian dominance that are at equal frequency (p0.5. q 0.5). Assume this first generation is at hardy Weinberg equilibrium. Calculate the genotype frequencies AA- a. Aa b. Now assume some environmental change that makes the recessive phenotype completely unfit (fitness- 0). Calculate the allele frequencies and genotype frequencies in the second generation. (Hint: Your calculations might be easier if...