Explain in detail: Why does DNA form a double-helical structure?
Explain in detail:
Why does DNA form a double-helical structure?
Homework Answers
Answer - It is usually a double helix because it is the most stable form a DNA can be. It is also not easily degraded by the various nucleases that are present inside the cell. And lastly, a double helical form provides a smoother platform to replicate.
Art-Labeling Activity: Structure of the nucleic acids DNA and RNA Reset Double-helical DNA Sugar-phosphate backbone (RNA)...
Art-Labeling Activity: Structure of the nucleic acids DNA and RNA Reset Double-helical DNA Sugar-phosphate backbone (RNA) Hydrogen bonds Complementary base pairing Phosphate group Deoxyribose Single-stranded RNA Sugar-phosphate backbone (DNA) Base uracil in place of thymine OR AO
Describe how the biochemistry of DNA can explain the DNA double helix structure.
Describe how the biochemistry of DNA can explain the DNA double helix structure.
Question 7 What is the structure of DNA at the level above the nucleotide? Ladder-like double...
Question 7 What is the structure of DNA at the level above the nucleotide? Ladder-like double helix with sugar phosphate backbone forming the rungs of the “ladder” Single-stranded helical structure with sugar phosphate backbone connecting individual nucleotides Single-stranded helical structure with complementary base pairs connecting individual nucleotides Ladder-like double helix with complementary base pairs forming the rungs of the “ladder”
6. Poly-L-glutamate can form -helical structure, but only below pH 2. Explain.
6. Poly-L-glutamate can form -helical structure, but only below pH 2. Explain.
Write the base sequence of the complementary strand of double helical DNA in which one strand...
Write the base sequence of the complementary strand of double helical DNA in which one strand has the sequence 5' GTTCACCGTTCAAA 3'.
7. Which of the following shows a naturally observed DNA base pairing found in double helical...
7. Which of the following shows a naturally observed DNA base pairing found in double helical DNA: -H I O NH N NH N-H Z- I NH N- H H N-H H
Canvas Question 26 (Short answer) One strand of a double-helical DNA has the sequence (5')GCGCAATATTCTCAAAATAT(3"). A)...
Canvas Question 26 (Short answer) One strand of a double-helical DNA has the sequence (5')GCGCAATATTCTCAAAATAT(3"). A) Write the base sequence of the complementary strand. B) Explain what complementary means in nucleic acid chemistry BIVA-A I E III XX, E - 2 x C1 12pt Paragraph O words 31
Select the phrases that accurately describe properties of the most common form of the DNA double helix
Select the phrases that accurately describe properties of the most common form of the DNA double helix. There is more than one correct answer. Select all that apply. DNA contains equal amounts of adenine and thymine, and equal amounts of cytosine and guanine. A helical turn consists of about 10 nucleotides. Base pairs have a spacing of 20 A. The phosphodiester bonds between nucleotide residues run in opposite directions in the two strands. The nitrogenous bases are exposed to the solvent, whereas the sugar-phosphate backbone of...
1. Explain the antiparallel DNA structure. (5 points) 2. How does a DNA molecule code for...
1. Explain the antiparallel DNA structure. (5 points) 2. How does a DNA molecule code for a protein. Describe the process completely. (10 points) 3. How does DNA replication ensure accuracy. (5 points)
Question 1 1 pts Why is it important for DNA to have complementary base pairing? O...
Question 1 1 pts Why is it important for DNA to have complementary base pairing? O Complementary base pairing allows base pairs to be packed in the most energetically favorable arrangement inside of the double helix structure. O Complementary base pairing will pair a purine with a purine, which are a similar width, thus they are able to hold the sugar-phosphate backbone an equal distance apart along the DNA molecule o Complementary base pairing is only important for maintaining the...
Art-Labeling Activity: Structure of the nucleic acids DNA and RNA Reset Double-helical DNA Sugar-phosphate backbone (RNA) Hydrogen bonds Complementary base pairing Phosphate group Deoxyribose Single-stranded RNA Sugar-phosphate backbone (DNA) Base uracil in place of thymine OR AO
7. Which of the following shows a naturally observed DNA base pairing found in double helical DNA: -H I O NH N NH N-H Z- I NH N- H H N-H H
Canvas Question 26 (Short answer) One strand of a double-helical DNA has the sequence (5')GCGCAATATTCTCAAAATAT(3"). A) Write the base sequence of the complementary strand. B) Explain what complementary means in nucleic acid chemistry BIVA-A I E III XX, E - 2 x C1 12pt Paragraph O words 31
1. Explain the antiparallel DNA structure. (5 points) 2. How does a DNA molecule code for a protein. Describe the process completely. (10 points) 3. How does DNA replication ensure accuracy. (5 points)
Question 1 1 pts Why is it important for DNA to have complementary base pairing? O Complementary base pairing allows base pairs to be packed in the most energetically favorable arrangement inside of the double helix structure. O Complementary base pairing will pair a purine with a purine, which are a similar width, thus they are able to hold the sugar-phosphate backbone an equal distance apart along the DNA molecule o Complementary base pairing is only important for maintaining the...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago