HomeworkLib
Question

Perform a Google search, using the Google hacking keywords to locate a page that has the...

Perform a Google search, using the Google hacking keywords to locate a page that has the word passwd (note the spelling) on the page but has the phrase "Index of" in the title. First, what was your search term. Second, what is the first URL in your list of results. Third, what exactly would you use this search to find?

engineering   Computer-Science   
0 0
Add a comment Improve this question Transcribed image text
Next > < Previous
Sort answers by oldest

Homework Answers

Answer #1

Answer:

First,

The search term that I used was: intitle passwd

Second,

The first URL in the list was: (Links to an external site.) http://gray-world.net/etc/passwd/ - Gray-World.net

Third,

You would use this command to find user name, home directory, user ID, group ID's, and full name of users.

0 0
Add a comment
Know the answer?
Add Answer to:
Perform a Google search, using the Google hacking keywords to locate a page that has the...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Log In

Sign Up

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions

  • Google dorking, or using advanced Google search techniques to find sensitive information, has been likened to...

    Google dorking, or using advanced Google search techniques to find sensitive information, has been likened to “online dumpster diving.” Use the Internet to research Google dorking. First, use the Internet to determine how the following advanced Google search engine operators are used: allintext, allintitle, allinurl, cache, filetype, inanchor, intest, intitle, link, site, +, |, and *. Then, use at least five of the operators to create potential Google dorking searches. Finally, try out your searches to see if they are...

  • • Perform a web-search and locate information on the ONC 2015 Edition criteria located at 2015...

    • Perform a web-search and locate information on the ONC 2015 Edition criteria located at 2015 Edition Test Method (Links to an external site.)Links to an external site.. Each criterion (e.g. 170.315(a)(1) CPOE - Medications) has its own Certification Companion Guide and Test Procedure. • Select one criterion that relates to the information you saw in the Vista Simulation and review that criterion’s Test Procedure. - Note: When reviewing the ONC website please be sure to scroll down the page...

  • Assume there are 100,000 unique web pages* and answer the following: 5a) A Google search returns...

    Assume there are 100,000 unique web pages* and answer the following: 5a) A Google search returns a first page of 20 results each in a ranked order. How many possible first page rankings are there for the 100,000 web pages? BONUS: 5b) How many rankings of 20 pages are there if two of the 100,000 pages are duplicates. Hint: You might need to use the rule of sum. 5c) In Information Retrieval, a field of Data-Mining for correctly returning search...

  • Then, search the Internet, like on Google or Bing, and put Gender and Diversity in the...

    Then, search the Internet, like on Google or Bing, and put Gender and Diversity in the Workplace in the Search Box. Search and select the articles you want to use for this paper. (Note: Do not use information from BLOGS or from Wikipedia for your paper; these are open-source and the information cannot be validated as accurate.) Gender and Diversity in the Workplace The role of gender and ethnicity can shed light on how individuals react within a group. Use...

  • The binary search algorithm from Chapter 9 is a very efficient algorithm for searching an ordered...

    The binary search algorithm from Chapter 9 is a very efficient algorithm for searching an ordered list. The algorithm (in pseudocode) is as follows: highIndex - the maximum index of the part of the list being searched lowIndex - the minimum index of the part of the list being searched target -- the item being searched for //look in the middle middleIndex = (highIndex + lowIndex) / 2 if the list element at the middleIndex is the target return the...

  • Objective Learn about String methods Work with the Python documentation Specifics Perform a simple Google search...

    Objective Learn about String methods Work with the Python documentation Specifics Perform a simple Google search (or use any other search engine) on “Python String methods”. One of the first links will be to the Python webpage detailing the built-in data types. This page contains a description of the methods available in String variables. You may use other webpages for this assignment, but you need to be aware of the official documentation for the language. The webpage lists methods that...

  • Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an...

    Use BLAST to find DNA sequences in databases Perform a BLAST search as follows: Do an Internet search for “ncbi blast”. Click on the link for the result: BLAST: Basic Local Alignment Search Tool. Under the heading “Basic BLAST,” click on “nucleotide blast”. pMCT118_F   5’- GAAACTGGCCTCCAAACACTGCCCGCCG -3’ (forward primer) pMCT118_R   5’- GTCTTGTTGGAGATGCACGTGCCCCTTGC -3’ (reverse primer) Enter the pMCT118 primer (query) into the search window. (see Moodle metacourse page for the file – just copy and paste the sequence into the...

  • 1. The key to high ranking in search results is to make sure that your website...

    1. The key to high ranking in search results is to make sure that your website has the right ingredients that search engines need to prepare search results. What are they? A. Title of each page B. Links from other web sites that are directed to your web pages C. The freshness of content D. All of the above 2. Fraudulent transactions often show very distinct patterns. All of the following are some examples of them EXCEPT: A. The order...

  • Read the case study "Google, Apple, and Facebook Struggle for Your Internet Experience" on page 255....

    Read the case study "Google, Apple, and Facebook Struggle for Your Internet Experience" on page 255. Then discuss the advantages and disadvantages for each company. BUSINESS PROBLEM-SOLVING CASE Google, Apple, and Facebook Battle for Your Internet Experience Apple has a legacy of innovation on its side. In Three Internet titans Google, Apple, and 2011, it unveiled the potentially market disrupting Facebook are in an epic struggle to dominate your Siri (Speech Interpretation and Recognition Internet experience, and caught in the...

  • Python Help Please! This is a problem that I have been stuck on.I am only suppose...

    Python Help Please! This is a problem that I have been stuck on.I am only suppose to use the basic python coding principles, including for loops, if statements, elif statements, lists, counters, functions, nested statements, .read, .write, while, local variables or global variables, etc. Thank you! I am using python 3.4.1. ***( The bottom photo is a continuation of the first one)**** Problem statement For this program, you are to design and implement text search engine, similar to the one...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT