a) stop codons and their modified amino acids-
1. UGA- selenocysteine
2. UAG- pyrrolysine
b) Encoding a mutant amino acid is beneficial to study protein functioning and important amino acids involved in it . Protein function is dependent on its structure and a changed or modified amino acid will alter the structure and hence, the function identifying essential amino acids.
c) Mutant amino acids code for different amino acids than normally present in a protein, forming modified amino acid. These proteins can be produced to have higher activity, higher substrate specifity and other functions.
E. Coli have been genetically modified to create tRNAs that recognize stop codons. Name an example...
The gene encoding protein Bog in E. coli has been changed by a point mutation in its open reading frame. Originally the gene encoded a 108 amino acid long functioning protein whose amino acid composition favored nonpolar and negatively charged amino acids. After the mutation it encodes a 110 amino acid long non-functioning protein that is now rich in polar uncharged amino acids and positively charged amino acids. Which mutation scenario best explains this observation. A) A frame-shift caused by...
QUESTION 34 The gene encoding an E. coli tRNA containing the anticodon 5'-GUA-3' mutates so that the anticodon now is 5'-UUA-3'. What will be the effect of this mutation? a. The bacterial ribosomes would stop translation whenever a tyrosine codon in a mRNA is positioned in the A site. b. The bacterial ribosomes would stop translation whenever a leucine codon in a mRNA is positioned in the A site. c. The bacterial ribosomes would compete with the termination factor to...
2. On the mRNA codon table, the first nucleotide in mRNA is to the left, the second is above, and third is to the right. On the sequence, the 5'cap is indicated by (5'). The poly (A) tail is not shown. Use the codon table to translate this short mRNA. Mark the codons and write the amino acid sequence beneath them. (5') CGUUACAAUGUAUCGCGCGGUACUCGGCAAAGUGCCCUGAAUAGAGUUGGUA (3') 3. DNA polymerase made a mistake and added a C on the DNA template strand. In...
Problems 1) Look at the structure of the natural amino acids (look them up). What do the 8 primordial amino acids have in common (generally)? What do you notice about the ones with 2 or fewer codons? 2) Calculate the actual information content per amino acid of protein translation by using the genetic code and the fact that in nature, the frequency of U and C is 22%, A is 30% and G is 26%. Finally, since 3 of 64...
6:35 5 minutes ago 25) Which of the following turns off transcription by binding to the operator? A) repressons B) lactose C) RNA polymerase D) promoters E) enzymes 25) 26) In bacteria, what name is given to a cluster of genes with related functions, along with their control 26) A) exon B) operon C) promoter D) activator E) regulatory gene A mutant bacterial cell has a defective aminoacyl synthetase that attaches a lysine to tRNAs with the anticodon AAA instead...
want to double check!
25. Th e DNA sequences encoding the initiation whese parated bcoding the initiation and termination codons of a certain protein amino acids in length. there of the protei nucleotides on a certain organism's chromosome; however ssuming that there has been no post-translational processing elined from this gene is translated, the protein product is only 250 A. The RNA was synthesized in a bacterial cell n, what can you conclude from these observations? The RNA was synthesized...
5.
Genetics. Please provide complete, correct and verified solution
done on computer or by hand. This is all the information provided.
Please only provide answers. Thank you very much.
positions would you expecr 16. The figure below shows a replication fork in E. coli.At which of the indicated positions would you expect to see a 3'OH? A. B. D. E. A and B 17. Select the TRUE statement. E. coli mRNA A. is produced from both DNA template strands at...
What are the three functional groups that comprise a nucleotide? What do nucleotides have in common with amino acids or simple sugars? When the structure of DNA was first elucidated, many biologists quickly saw how this structure explained the passage of information from one generation to another. How does the structure of DNA explain generation-to-generation flow of information? In other words, give a brief description of the structure of DNA and tell how this structure allows for replication. Which of...
The strain of XDR-TB that the young man had above was studied further by analyzing the DNA of the Mycobacterium tuberculosis. The investigators particularly looked at the gene for the protein targeted by the antibiotic rifampin. MDR-TB and XDR-TB are resistant to rifampin. Q1. What is the protein target for rifampin in the bacterial cells? What biological process does the antibiotic stop? (see notes). The following results were obtained from the young man's M. tuberculosis for the DNA sequence of...
29. Which of the following would be synthesized in and processed by the smooth endoplasmic reticulum and Golgi apparatus? A. lipids and steroids B. DNA polymerase and RNA polymerase C. lysosomal enzymes D. cytoskeletal proteins 30. Which of the following are processed in the Golgi apparatus? A. integral membrane proteins of the plasma membrane B. proteins that are secreted from the cell C. proteins that will be broken down by lysosomes D. all of the above E. none of the...