1. If the surface of the Mg ribbon you used were covered with a thin oxide...
1. If the surface of the Mg ribbon you used were covered with a thin oxide coating prior to the reaction, would your product appear to be Mg-rich or Mg-poor? Explain. The mass increase would be (greater than, less than, equal to) what pure Mg reactant would predict. 2. Select the modifications to the procedure that would be more likely...
1. Give a sequence of reactions to accomplish the following transformation? Show mechanism 2. What reagent(s)...
1. Give a sequence of reactions to accomplish the following transformation? Show mechanism 2. What reagent(s) would accomplish the following? Show mechanism. R-CH2-NH2 R-C-NH2 3. What would result from the reactions shown below? Hsco-s-OCH3 large excess) NaOH нон H,0 но ОН "ОН (a and B) 4. Predict the major product of the following reaction. CHNNH 3 equivalents) но CHCH2OH Heat...
Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict...
Below is the DNA sequence of a protein-encoding Eukaryotic gene: 5’TAAACGCGATGGACCGACCATACAGTATCGACGCTCCAGGATGGTAAAATAAATGCCT3’ Based on this information, predict the mature mRNA sequence and the corresponding peptide sequence of this gene after transcription, RNA processing, and translation. Try to recognize and label the sequence features on the primary transcript you learned from the class that are important for Eukaryotic mRNA Processing (e.g. intron...
please provide detailed explanation of solution for thumbs up 6. Reaction Coordinate Diagrams (10 points) (a)...
please
provide detailed explanation of solution for thumbs up
6. Reaction Coordinate Diagrams (10 points) (a) Sketch an accurate energy diagram that meets the following criteria (4 points) SM - OM Int - P SM - Int is endergonic and the slowest step. overall SM + P is exergonic. al Free Energy (G) Reaction Coordinate (b) Label the transitions states...
Pre-Lab Assignment. Experiment: Determination of Unknown compounds Name (please print) Section Date You have a set...
Pre-Lab Assignment. Experiment: Determination of Unknown compounds Name (please print) Section Date You have a set of 5 bottles with "unknown" ionic compounds: Lead Il acetate, Formula: Potassium iodide, Formula:_ Sodium chloride, Formula: Mercury i chioride, Fermia Hg cho Silver nitrate, Formula: P Mercury Il chloride, Formula: - but you don't know which is in which bottle. Your mission is...
A chemical engineer is studying the following reaction: 4 HCI (g)+02(g) → 2 H 20(g)+ 2...
A chemical engineer is studying the following reaction: 4 HCI (g)+02(g) → 2 H 20(g)+ 2 Cl 2(g) At the temperature the engineer picks, the equilibrium constant Kp for this reaction is 0.38. The engineer charges (fills") four reaction vessels with hydrogen chloride and oxygen, and lets the reaction begin. He then measures the composition of the mixture inside each...
QUESTION: Draw an arrow-pushing mechanism for the FIRST STEP of this synthetic sequence. In this laboratory...
QUESTION: Draw an arrow-pushing mechanism for the FIRST STEP of
this synthetic sequence.
In this laboratory experiment, you will synthesize a RTIL, 1-hexyl-3-methylimidazolium hexafluorophosphate, using a two-step process involving nucleophilic substitution and anion exchange. 1-Hexyl-3-methylimidazolium hexafluorophosphate and its structural analogs have long names. Therefore, they are often abbreviated as [Cn-mim X, where n = the number of carbons in the...
1. Saccharin is an artificial sweetener that was discovered in 1879 when a chemist spilled some...
1. Saccharin is an artificial sweetener that was discovered in 1879 when a chemist spilled some of his product on his sandwich, and when he ate his sandwich discovered it was particularly sweet. It is synthesized according to the following reaction and the product is isolated after addition of HCI. -NH₂ + NaOH + KMnO4 NH OS=0 a) What safety...
You want to determine AH for the reaction Zn(s) + 2HCl(aq) → ZnCl2(aq) + H2(g) To...
You want to determine AH for the reaction Zn(s) + 2HCl(aq) → ZnCl2(aq) + H2(g) To do so, you first determine the heat capacity of a calorimeter using the following reaction, whose AH is known: NaOH(aq) + HCl(aq) + NaCl(aq) + H2O(1) -57.32 kJ (a) Calculate the heat capacity of the calorimeter from these data: Amounts used: 50.0 mL of...
6. (30 points) Given reaction: Ba(OH)2(aq) + 2 HCl(aq) → BaCl2(aq) + 2H20(0) AH = ....
6. (30 points) Given reaction: Ba(OH)2(aq) + 2 HCl(aq) → BaCl2(aq) + 2H20(0) AH = . 118 kJ A student mixed 200.0 mL of 0.200 M HCl with 350.0 mL of 0.200 M Ba(OH)2 in a coffee cup calorimeter at 25.0°C (The initial temperatures of both solutions and the cup were 25.0°C). The heat capacity of the imeter is 58.3J/°C....
1. Give a sequence of reactions to accomplish the following transformation? Show mechanism 2. What reagent(s) would accomplish the following? Show mechanism. R-CH2-NH2 R-C-NH2 3. What would result from the reactions shown below? Hsco-s-OCH3 large excess) NaOH нон H,0 но ОН "ОН (a and B) 4. Predict the major product of the following reaction. CHNNH 3 equivalents) но CHCH2OH Heat...
please
provide detailed explanation of solution for thumbs up
6. Reaction Coordinate Diagrams (10 points) (a) Sketch an accurate energy diagram that meets the following criteria (4 points) SM - OM Int - P SM - Int is endergonic and the slowest step. overall SM + P is exergonic. al Free Energy (G) Reaction Coordinate (b) Label the transitions states...
Pre-Lab Assignment. Experiment: Determination of Unknown compounds Name (please print) Section Date You have a set of 5 bottles with "unknown" ionic compounds: Lead Il acetate, Formula: Potassium iodide, Formula:_ Sodium chloride, Formula: Mercury i chioride, Fermia Hg cho Silver nitrate, Formula: P Mercury Il chloride, Formula: - but you don't know which is in which bottle. Your mission is...
A chemical engineer is studying the following reaction: 4 HCI (g)+02(g) → 2 H 20(g)+ 2 Cl 2(g) At the temperature the engineer picks, the equilibrium constant Kp for this reaction is 0.38. The engineer charges (fills") four reaction vessels with hydrogen chloride and oxygen, and lets the reaction begin. He then measures the composition of the mixture inside each...
QUESTION: Draw an arrow-pushing mechanism for the FIRST STEP of
this synthetic sequence.
In this laboratory experiment, you will synthesize a RTIL, 1-hexyl-3-methylimidazolium hexafluorophosphate, using a two-step process involving nucleophilic substitution and anion exchange. 1-Hexyl-3-methylimidazolium hexafluorophosphate and its structural analogs have long names. Therefore, they are often abbreviated as [Cn-mim X, where n = the number of carbons in the...
1. Saccharin is an artificial sweetener that was discovered in 1879 when a chemist spilled some of his product on his sandwich, and when he ate his sandwich discovered it was particularly sweet. It is synthesized according to the following reaction and the product is isolated after addition of HCI. -NH₂ + NaOH + KMnO4 NH OS=0 a) What safety...
You want to determine AH for the reaction Zn(s) + 2HCl(aq) → ZnCl2(aq) + H2(g) To do so, you first determine the heat capacity of a calorimeter using the following reaction, whose AH is known: NaOH(aq) + HCl(aq) + NaCl(aq) + H2O(1) -57.32 kJ (a) Calculate the heat capacity of the calorimeter from these data: Amounts used: 50.0 mL of...
6. (30 points) Given reaction: Ba(OH)2(aq) + 2 HCl(aq) → BaCl2(aq) + 2H20(0) AH = . 118 kJ A student mixed 200.0 mL of 0.200 M HCl with 350.0 mL of 0.200 M Ba(OH)2 in a coffee cup calorimeter at 25.0°C (The initial temperatures of both solutions and the cup were 25.0°C). The heat capacity of the imeter is 58.3J/°C....
Most questions answered within 3 hours.