Question

Biologists use gel electrophoresis to sort DNA segments by size. DNA segments are placed at one...

Biologists use gel electrophoresis to sort DNA segments by size. DNA segments are placed at one end of a gel. DNA is negatively charged (with a charge of two electrons per base pair). When you “run the gel” you are generating an electric field by connecting anodes and cathodes at the ends of the gel. This causes the negatively charged DNA segments to move towards the positive electrode. After running the gel, smaller DNA segments have moved farther from the starting end. The overall theme for this question is: Why do the smaller DNA segments move farther?

(a) Each base pair of a DNA molecule has a negative charge of -2e. Defining whatever variables you find appropriate, come up with an expression for: i) the total charge of a DNA segment of N base pairs (1 point) ii) the total mass of a DNA segment of N base pairs (1 point)

(b) To understand how electrophoresis might work we will start with a simple model. We will ignore the gel and assume that the only force acting on the DNA segments is the electric force due to a constant electric field. Starting with a free body diagram, produce an equation that describes how the electrostatic force acts on DNA segments of different sizes. Use Newton’s 2nd law to decide how this force would affect the motion of different-sized segments of DNA. Does this explain how electrophoresis separates DNA segments by size? (2 points) Continues on the next page… HW 2 PH 142 Total: 35 Points Due: 01/25/19 at 5pm

(c) In reality the gel exerts a significant drag force on the DNA segments. Drag forces are proportional to the cross-sectional area of an object, as we saw last semester. Here we want to learn something about the structure of DNA in solution based on the behavior observed in the electrophoresis gel. We will choose between three models for the structure of DNA that describe how its size and shape change with the number of base pairs:

(i) A long stiff rod, where the length increases in proportion to the number of base pairs, l = aN.

(ii) A compact sphere, where the radius increases slowly with the number of base pairs, r = aN1/3.

(iii) A loose spherical coil, where the radius increases rapidly with the number of base pairs, r = aN3/5. The value of the constant a is different in each case, but does not affect the result. Use a free body diagram to analyze the forces acting on the DNA segments. Find an equation that describe the terminal speed, v, of the DNA is related to the number of base pairs in a DNA segment for each model above. Which model agrees with the results seen during electrophoresis? Ask yourself based on the equations how the terminal speed changes with the number of base pairs N in the DNA. Hint: You will have to describe both the charge and the cross-sectional area of the DNA in terms of the number of base pairs N. (8 points)

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Gel electrophoresis is technique used for separation of nucleic acids.Separation of macromolecules depends upon two variables:charge and mass.In the gel electrophoresis for DNA these two variables act together.The electric current from one electrode repels the molecules while the other electrode attaracts the molecules.The frictional force of gel materials act as 'molecular sieve',separating the molecule by size.During electrophoresis ,macromolecules forced to move though the pores and their rate of migration through the electric fields depend upon the following:

a) Size and shape of molecules

b) Streangth of field

c) Relative hydrophobicity of samples

To understand the separation of charged particles in gel electrophoresis,it is imtortant to look at simple equation relating to electrophoresis.When a votage is applied across the the electrodes ,a potential gradient,E, is generated and can be expressed by equation,

E=V/d

where V is applied voltage and d is distance between the electrodes and,

F=Eq

where F is force genereted on charge q bearing on molecule and that force drive a chage molecule toward an electrode.

There is also frictional resistance that slow down the movement of charged molecules.This frictional force is function of:

a) Size of molecule

b) Shape of molecule

C) the pore size of medium in which electrophoresis take place

Thus, velocity is function of potential gradient , charge and frictional forces and that can be expressed by the eqation as follows:

v=Eq/f

where f is frictional coefficient.The electrophoretic mobility of ion can be defined as ion's velocity devide by their potential gradient.

M=v/E thus, M=q/f

When a potential difference is applied,molecule with different overall charges will begin to separate due to their different electrophoretic mobility.The mobility is significant parameter of charged molecule and depend upon charged group and size of molecule or particle. Even molecule with similar charges will begin to separate if they have different molecular sizes,since they will experience different frictional forces.DNA migrate through the gel matrices at that is inversly proportional to no. of base pairs.Larger molecules migrate moreslowy because of greater friction drag and because of less efficient movement through the pores of gel.

Add a comment
Know the answer?
Add Answer to:
Biologists use gel electrophoresis to sort DNA segments by size. DNA segments are placed at one...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Question 4-12 points Biologists use gel electrophoresis to sont DNA segments by size. DNA segments are...

    Question 4-12 points Biologists use gel electrophoresis to sont DNA segments by size. DNA segments are placed at one end of a gel. DNA is negatively chargod (with a charge of two electrons per base pair). When you "run the gel" you are generating an electric field by connecting anodes and cathodes at the ends of the gel This causes the negatively charged DNA segments to move towards the positive electrode. After nunning the gel, smaller DNA segments have moved...

  • DNA Electrophoresis: a) The DNA reaches terminal velocity quickly during electrophoresis and stays in that state....

    DNA Electrophoresis: a) The DNA reaches terminal velocity quickly during electrophoresis and stays in that state. Solve for the terminal velocity for the viscous and drag force case. b) Which of these terminal velocities depend on the size of the DNA molecule? How does the terminal velocity change with molecule size? ( does terminal velocity go up or down as the size gets bigger?) c) Based on your calculations is the resistive force on a DNA molecule during electrophoresis best...

  • To understand how electrophoresis might work we will start with a simple model. We will ignore...

    To understand how electrophoresis might work we will start with a simple model. We will ignore the gel and assume that the only force acting on the DNA segments is the electric force due to a constant electric field. Starting with a free body diagram, produce an equation that describes how the electrostatic force acts on DNA segments of different sizes. Use Newton’s 2nd law to decide how this force would affect the motion of different-sized segments of DNA. Does...

  • Gel Electrophoresis of Amplified PCR Samples 9. What is Alu? 10. Why is Alu useful for...

    Gel Electrophoresis of Amplified PCR Samples 9. What is Alu? 10. Why is Alu useful for studying human ancestry? 11. Why do the two possible PCR products from our lab differ in size by 300 base pairs? 12. Explain how gel electrophoresis separates DNA fragments 13. Fill in the table below. For each genotype, write how many DNA bands (fragments) you would expect to see in a gel, along with the size of each (n base pairs) Table 1. Predicted...

  • 6. Gel Electrophoresis separates different molecules on the basis of A) Size B) charge C) solubility...

    6. Gel Electrophoresis separates different molecules on the basis of A) Size B) charge C) solubility D) both size and charge 7. Distinguish between leading and lagging strand. 8. How is DNA replication different in eukaryotes from bacteria? 9. Explain semiconservative model of DNA replication 10. Distinguish between helicases and topoisomerases

  • DNA Electrophoresis a) Find terminal velocity in um/s b)  Draw a FBD (free-body diagram) for the DNA...

    DNA Electrophoresis a) Find terminal velocity in um/s b)  Draw a FBD (free-body diagram) for the DNA molecule in the gel Our Gel: Information about the gel in Figure 1: • Run Time: 105 minutes. • The DNA sample contained 13 different sizes of DNA molecules (Table 1). The apparatus delivered a potential difference of 80 Volts across the gel. The distance between the electrodes was 19 cm. • This Voltage difference creates an electric field of 421 V/m (421 N/C)...

  • One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the...

    One strand of a DNA sequences is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. CP22: vne strand of a DNA sequence is given below. Find the EcoRI sites and indicate the cutting site with an arrow. Count the number of bases in each fragment. Restriction digest A: ATTGAATTCCGGTTAGCTTTAGAATTCCGCCATATGCGCAATTGGAATTCC Number of bases in each fragment: Now compare the same region of DNA from another individual. Where...

  • can someone explain throughly on how to find a-c??? thanks!!! The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel be...

    can someone explain throughly on how to find a-c??? thanks!!! The following question will provide practice in interpreting and analyzing gel results. 5. You obtained the DNA electrophoresis gel below. Three samples of lambda phage DNA were digested with 3 different restriction enzymes and the digested DNA was applied to the gel in lane 4 and the bands were visualized. The Hind Ill digest was used as a molecular weight standard marker and produced 6 DNA fragments of known size:...

  • Question 5 The size of a piece of DNA can determine how fast or slow it travels during gel electrophoresis. True...

    Question 5 The size of a piece of DNA can determine how fast or slow it travels during gel electrophoresis. True False Question 6 Radioactive probes attach to the complimentary base during some DNA lab processes. For instance a C would attach to a G and a T would attach to an A (nucleic acids). True False Question 7 How could/might all of this type of information at some point in time impact you personally (or your family members)? (Consider...

  • DNA inside living cells becomes charged as each base pair steals a pair of electrons from...

    DNA inside living cells becomes charged as each base pair steals a pair of electrons from surrounding water molecules and releases a pair of hydrogen ions. (a) Do some research and determine the typical number of base pairs in a human chromosome (Not the number in the Y chromosome!). Your answer should include a reference to the source or sources used to produce your answer. (3 Points) (b) Estimate the electric force between two typical chromosomes assuming that they are...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT