Question

2. Youve identified a mutant allele for a new gene in mice that causes muscle hypertrophy Youve named the gene Mh, so the wild-type allele is Mh, while the big-muscle mutant allele youve designated as Mh89, You believe this gene is involved in muscle growth and development, but you havent been able to isolate the protein yet. You also do not know exactly where the mutation is in the gene, but you do know that the mRNA transcript of the Mh8 mutant allele is longer In addition to having more muscle mass, youve noticed that the mutant mice always have light gray coat color, as opposed to the standard white coat of your wild-type strain. So youd like to determine if one coat color is more likely to have one allele over another. Youre going to explore this hypothesis using a Northern blot. a) Why is a Northern blot a better choice than a Western blot at this point of knowledge about the gene (1-2 sentences, 1 point) b) Youve already isolated and purified RNA samples from both light gray and white mice and have your gels ready to go for electrophoresis. What else do you need to be able to perform a Northerm blot? (1 point) c) Your Northern blot results are shown below for 3 white coat mice and 6 light gray coat mice. Based on this information, do you think its likely that different alleles for the Mh gene also contribute to coat color? What else can you determine about the relationship between the two alleles and the coat color phenotype? Explain your answer. (2-3 sentences, 1 point) coat color & individual samples white white white gray gray gray gray gray gray ladder #1 #2 #3 #1 #2 #3#4#5#6 10 kb 100 bp page 2 of 2
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Ans:- ) Northen blot :- this is a technique that is specifically used to detect a specific type of gene or mRNA seq from the given sample

Western blot :- this is a technique that is mainly used to detect specific type of protein from a mixture of protein the method is usually based on Ag antibody reaction

Ans 2):-steps of northen blot process :-

  1. RNA is extracted from the sample and separated by gel electrophoresis.
  2. RNA is transferred from gel to bloting membrane and fixed
  3. The membrane is treated with labeled probe prepared from cDNA or RNA .
  4. The probe is then incubated with membrane so that it bindwith specific type of sequence
  5. Unbound probes are washed off
  6. Hybridized fragments are then detected with an autoradiograph

Ans3:-) yes it will contribute to the coat color. the relationship between two allele and phenotype depends on the dominant and the recessive trait if it is dominant than it requires only one copy of gene to appear on the body and if it is recessive then two copies are required to appear.

Add a comment
Know the answer?
Add Answer to:
2. You've identified a mutant allele for a new gene in mice that causes muscle hypertrophy...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Please answer the below genetics question and show/explain all work. 4. You've recently discovered the sequences...

    Please answer the below genetics question and show/explain all work. 4. You've recently discovered the sequences for two alleles for the mouse gene XCD, which you have creatively named XCD and XCD2. This gene is believed to be involved in fat metabolism, somehow, but you haven't successfully been able to isolate the protein yet. You've also noticed that your mutant grey coat mice tend to be much leaner and muscular than those with the standard white coat. So for your...

  • In mice, the dominant allele Gs of the X-linked gene Greasy produces shiny fur, while the...

    In mice, the dominant allele Gs of the X-linked gene Greasy produces shiny fur, while the recessive wild type Gs+ allele determines normal fur. The dominant allele Bhd of the X-linked Broadhead gene causes skeletal abnormalities including broad heads and snouts, while the recessive wild-type Bhd+ allele yields normal skeletons. Female mice heterozygous for the two alleles of both genes were mated with wild-type males. Among 100 male progeny of this cross, 49 had shiny fur, 48 had skeletal abnormalities,...

  • For this problem: In mice, a single gene controls yellow fur color. The Y allele is...

    For this problem: In mice, a single gene controls yellow fur color. The Y allele is dominant and produces yellow fur, the y allele is recessive and results in white fur. When you cross two heterozgyous yellow mice (Yy x Yy), you find that you get 20 yellow offspring and 10 white offspring. That should tell you what kind of genetics and the probability of getting a single yellow or white mouse. What is the probability first picking a first...

  • In gerbils there is a recessive mutant gene that causes a lethal condition. For the purpose...

    In gerbils there is a recessive mutant gene that causes a lethal condition. For the purpose of this problem let the symbol A denote the normal allele and a the mutant. In heterozygote individuals who carry both versions of the allele (Aa), this causes a white spotting color pattern. Homozygotes for the mutant (aa) die as embryos and are never seen in live gerbils. Since the mutant allele is lethal in the homozygous form, natural selection will occur against the...

  • 1) Coat color in mice is determined by several independently assorting autosomal genes. Gene A is...

    1) Coat color in mice is determined by several independently assorting autosomal genes. Gene A is involved in the distribution of pigment along the hair. A dominant allele (A) produces a hair color called "agouti"--the hair has dark pigment at the base and tip of each hair shaft and yellow pigment in the central portion of the shaft. Homozygous recessive mice (aa) are missing the yellow stripe and thus have solid dark-colored hair. Gene B is involved in the color...

  • 19. Two different gene loci are responsible for determining mouse coat color. A recessive lethal allele...

    19. Two different gene loci are responsible for determining mouse coat color. A recessive lethal allele contributing to yellow coat color also exists for one of these two gene loci. The following genotypic and phenotypic information about the mouse coat color alleles is known: (6) Agouti = A-B- • Yellow = AA'B-or A'aB-or A'ab- Lethal (inviable zygote) = A'A- Black = aaB- Albino = -bb a. A cross is made that produces 2 yellow, 1 black, and 3 albino mice....

  • EXPLAIN SHOW WORK PLEASE. A recessive allele (d) of the dancer gene in mice affects the...

    EXPLAIN SHOW WORK PLEASE. A recessive allele (d) of the dancer gene in mice affects the inner ear and results in mice with balance problems and an unusual gait. You learned in class that the A gene, which is on a different chromosome, has an allele, AY,that is dominant for yellow coat color and recessive lethal. You cross a pure-breeding line of dancer mice that have normal coats to a strain with normal gait and yellow coats. In the resulting...

  • A Mutation in the Myostatin Gene Increases Muscle Mass and Enhances Racing Performance in Heteroz...

    Can someone please help me with numbers 4 and 5? A Mutation in the Myostatin Gene Increases Muscle Mass and Enhances Racing Performance in Heterozygote Dogs Assignment 2 Below are the sequences of wildtype and mutant alleles of the myostatin gene discussed in the paper introduction Wildtype Allele: AATTACTGCTCTGGAGAGTGTGAATTTGTG Mutant Allele: AATTACTGCTCTGGAGAGTGAATTTGTGTT 1) Using the genetic code table (provided on page 2) and single-letter code for amino acids, write the amino acid sequences of both predicted proteins 2) What might...

  • RED EXTRA CREDIT EXERCISE: INTERACTION BETWEEN EVOLUTIONARY FORCES A species of mice inhabits a coastal plain...

    RED EXTRA CREDIT EXERCISE: INTERACTION BETWEEN EVOLUTIONARY FORCES A species of mice inhabits a coastal plain of white sand (See Fig. 1). The most common fur color ispale gray, making up 85% of the population. The dominant allele for coat color is black, with the recessive allele coding for the pale gray phenotype. The mice mainly feed on seeds from the local Moave grass, but a few (10%) are also able to digest the young growing shoots of the local...

  • A new gene is being investigated in fruit flies. The recessive allele of this gene (b)...

    A new gene is being investigated in fruit flies. The recessive allele of this gene (b) causes the wings to develop a blue color, while the dominant allele (b) permits wild-type colorless wings to develop. Preliminary studies indicate that this new gene is located on the X-chromosome. You decided to perform a two-point testcross to determine its position relative to the well-established garnet eyes gene (g). You cross a female heterozygous for both genes with a testcross male fly, and...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT