Question

Shown below is a polylinker that falls within the B-galactosidase coding region of the lacZ gene. This polylinker serves as a

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Sequence is :

Asp-Pro-Leu-Thr-Ile-Met-Ala-Tyr-Ile-Lys-Gln-Met

I identify Amino acid sequence we have to make group of three bases and corresponding Amino acid is chosen in sequence.

Add a comment
Know the answer?
Add Answer to:
Shown below is a polylinker that falls within the B-galactosidase coding region of the lacZ gene....
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Adenosine deaminases modify adenosines to form _____________________, which is then read as _________________________ by the translation...

    Adenosine deaminases modify adenosines to form _____________________, which is then read as _________________________ by the translation and splicing systems, as well as by reverse transcriptase. Cephalopods like squid and octopus use this form of editing very extensively in their protein-coding regions.  For each of the following, please indicate how these enzymes can alter the mRNA to produce the indicated codon changes.   I (Ileu)  is changed to V (val): K (Lys) is changed to E (Glu): T (Thr) is changed to A (ala):...

  • The next DNA sequence is the MATRICE strand of a small gene. What is the complete...

    The next DNA sequence is the MATRICE strand of a small gene. What is the complete amino acid sequence of the encoded peptide? GTCATGGCAACATAG 5'-3 Standard Genetic Code First position (5'end) U Second position UAU Tyr UAC Tyr UCA Ser UAA StopUGA Stop UAG Stop UUU Phe UUC Phe UUA Leu UUG Leu UGU Cys UGC Cys UCU Ser UCC Ser UCG Ser UGG Trp CUU Leu CUC Leu CUA Leu CUG Leu CCU Pro CCC Pro CCA Pr CCG...

  • I STARTED WRITING THE ANSWERS TO THIS PROBLEM. WE ARE TO COME UP WITH DNA SEQUENCES...

    I STARTED WRITING THE ANSWERS TO THIS PROBLEM. WE ARE TO COME UP WITH DNA SEQUENCES FROM THE MRNA SEQUENCE. AM I GOING IN THE RIGHT DIRECTION WITH THE DNA SEQUENCES FOR THIS PROBLEM ? 1.The wildtype sequence of part of a protein is: NH2-Trp-Trp-Trp-Met-Arg-Glu-Trp-Thr-Met…             Each mutant in the following table differs from wildtype by a single point mutation (base substitution). Using this information, determine the DNA sequence coding for the wildtype polypeptide. If there is more than one...

  • I don't know how to distinguish between the coding/noncoding strand on the problem. I have to put...

    I don't know how to distinguish between the coding/noncoding strand on the problem. I have to put fragment into cut segment and then determine what happened when that occurred and why the experimenter is receiving the observations she's getting. Please do ligation, transcription and translation. (IV). A cloning vector is cut with the restriction endonuclease Sma 1, whose restriction site is C C C (cut in between here, as shown in image) G G G and treated with alkaline phosphatase...

  • Question 10 (15 points) Given the following sequence for a template strand of DNA 3 -...

    Question 10 (15 points) Given the following sequence for a template strand of DNA 3 - ATACTTTGTCGAGACCCGCTTCTTGCAGACTGGG A. Provide the mRNA sequence following transcription (include polarity) B. Provide the amino acid sequence using either the one letter or three letter abbreviations. Include polarity (N-or C-terminus) and be careful to start in the correct place: C. What if the "C" underlined above was changed to a T. What is the new codon? How does that affect the amino acid sequence? What...

  • 21. One form of thalassemia has a single G->A mutation in the B-globin gene at the...

    21. One form of thalassemia has a single G->A mutation in the B-globin gene at the first nucleotide in the intron. This destroys the S' splice junction. The mRNA remains unspliced, leaving nucleotide intron in place. Assuming no stop codons are introduced in the intron pro second exon would be in-frame or out of frame in the translated protein dict if the A. In frame B. Out of frame Phe Ser Ty Cys U Phe Ser Cys Leu Se Stop...

  • The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the...

    The sequence below represents an eukaryotic gene which underwent a mutation (maroon). The arrow displays the transcriptional start site, as discussed during the class. (a) What is the sequence of the RNA that is transcribed? Write the sequence as 5' to 3: 5'CAGTACTATCCAAGACATGGCGACA 3' 3' GTCATGATAGGTTATGTACCGCTGT 5' -3. The RNA sequence is: 5'- (b) Write the peptide sequence that will be translated (if any) when this gene gets transcriptionally active. Use the genetic code provided below, and write the sequence...

  • The following genomic DNA sequence comes from the first exon of a human gene and contains...

    The following genomic DNA sequence comes from the first exon of a human gene and contains the 3'-end of the 5'-untranslated region and the start of a long open reading frame that codes for 200 amino acids (a.k.a. coding sequence). Note: There are no introns in this short portion and only one strand of the genomic DNA is shown. Which of the following answers lists the first three amino acids of the translated protein correctly? Seconed Position tyr ser leu...

  • If mutations occur at random, and changes to 1st or 2nd "letter" of a codon usually...

    If mutations occur at random, and changes to 1st or 2nd "letter" of a codon usually changes the amino acid coded for, but changes to the 3rd "letter" rarely do, roughly what % of mutations should be synonymous? Second АТ G UUU Phe UCU Ser UAU Tyr UGU Cys U 0 C | Phe UCC Ser UAC Tyr UGC Cys C Leu UCA Ser UAA Stop UGA Stop UUG Leu UCG Ser UAG Stop UGG Trp G CUU Leu CCU...

  • you are informed that CGATCA codes for an intron UUU)phe UCU UAU TVE UUC) Pne UCC...

    you are informed that CGATCA codes for an intron UUU)phe UCU UAU TVE UUC) Pne UCC Ser UAC 'yr UUA UCA Ser UUG Leu UCG) UGUve UGC Cys UAA Stop UGA Stop UAG Stop UGG Trp CGU) CGC CCU CUU CUC CCC Pro CAC His CỦA Leu CCA CCG) CAAGI CGA Arg CUG) CAGS CGG First letter DOC DOC DOC Doco Third letter AAU Asn AGU Ser AGC Se AAA Lys AGA Arg AAG AGG/Arg AUU ACU AUC lle ACC...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT