Question

Question 27 (1 point) CRISPR is a technique for altering: Cloned genes O Chromosogal DNA sequences OmRNA Vectors Page 27 of 4
0 0
Add a comment Improve this question Transcribed image text
Answer #1

CRISPR is a technology which is used for altering cloned genes. Hence, first option is correct.

Add a comment
Know the answer?
Add Answer to:
Question 27 (1 point) CRISPR is a technique for altering: Cloned genes O Chromosogal DNA sequences...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • omework Part D-Question 94 CRISPR-Cas9 can be used to 1:59 PM disable genes O fix disease...

    omework Part D-Question 94 CRISPR-Cas9 can be used to 1:59 PM disable genes O fix disease genes O add new genes O remave existing genes rk - watch two vidoo change gene sequences Submit My Answers Give Up Incorrect; Try Again; 5 attempts remaining ology Part E·Question #5 How does the CRISPR-Cas9 system speofically target DNA sequences n. All rights reserved licy Permissions O It make specific recombinant DNA sequences that match the target O It degrades the ONA from...

  • help Question 26 (1 point) Saving Among their other uses, tandem affinity tags can be used...

    help Question 26 (1 point) Saving Among their other uses, tandem affinity tags can be used to study: O Protein-protein interactions O CRISPR Vectors O Restriction endonucleases Next Page Page

  • 1.Phase variation controls protein levels by a. altering the DNA sequence. b. changing the rate of...

    1.Phase variation controls protein levels by a. altering the DNA sequence. b. changing the rate of mRNA translation. c. changing the rate of mRNA stability. d. changing the rate of protein stability 2.Chlamydomonas spp. can survive at freezing temperatures in their natural Antarctic environment. They have 39 different RNA helicase genes, and it has been hypothesized some of these are activated at freezing temperatures. What technique would be used to test this? a. ChIP-seq b. CRISR-Cas9 c. RT-PCR d. DNA...

  • Question 1: What was determined to be the function of the CRISPR loci in microbes? Question...

    Question 1: What was determined to be the function of the CRISPR loci in microbes? Question 2:   Explain the differences in the roles of the cas7 and cas9 gene. Question 3: What genetic material does CRISPR target? Question 4: Due to the ability of CRISPR to cleave DNA sequences at specific sites, it is considered a programmable version of what? Question 5: Define and explain the significance of the PAM sequence. Question 6: What is the role of tracrRNA in...

  • Question 38 (1 point) Saved As a general rule, certain amino acid sequences: Can only be determined by Edman degrad...

    Question 38 (1 point) Saved As a general rule, certain amino acid sequences: Can only be determined by Edman degradation O Can be associated with certain functions Never occur Can never be determined Next Page Page 38 of 40

  • Question 6 (1 point) Homologous recombination in yeast facilitates the segregation of genes during meiosis. O...

    Question 6 (1 point) Homologous recombination in yeast facilitates the segregation of genes during meiosis. O the targeted replacement of a gene in a living yeast cell. O the amplification of homologous yeast genes. the independent assortment of separate gene alleles. the expression of similar gene sequences via one promoter.

  • Question 38 Which of the following statements regarding CRISPR-Cas system is TRUE? Not yet answered Points...

    Question 38 Which of the following statements regarding CRISPR-Cas system is TRUE? Not yet answered Points out of 2.50 Select one: a. CRISPR-Cas system uses a DNA-directed nuclease to degrade viral RNA P Flag question O b. CRISPR-Cas system uses an RNA-directed nuclease to degrade viral DNA C. CRISPR-Cas system uses a RNA-directed nuclease to degrade viral RNA O d. CRISPR-Cas system uses a DNA-directed nuclease to degrade viral DNA e. CRISPR-Cas is a defense mechanism in eukaryotes against viral...

  • Question 13 (1 point) Alternative sigma factors initiate transcription in different genes by recognizing characteristic sequences...

    Question 13 (1 point) Alternative sigma factors initiate transcription in different genes by recognizing characteristic sequences in their 1) RNA polymerase 2) activation sites 3) promoters 4) enhancer 5) operator FUSION1 u point) Genes whose transcription is controlled by the same regulatory elements are said be under: 1) positive control 2) negative control 3) allosteric control 4) coordinated control 5) epigenetic control Question 16 (1 point) In the presence of both arabinose and glucose the arabinose operon is:

  • QUESTION 4 What is a transgenic organism? O an organism into which DNA from a different...

    QUESTION 4 What is a transgenic organism? O an organism into which DNA from a different organism is spliced O an organism that is both male and female an organism that is unable to reproduce offspring an organism that has a dominant genetic disorder O an organism that was cloned QUESTION 5 Which of the following statements correctly indicates the relationship among chromosomes, genes, and proteins? Proteins are found on chromosomes and code for genes. O A chromosome contains many...

  • Question 9 (1 point) Given the two complementary DNA sequences below from an E. coli gene...

    Question 9 (1 point) Given the two complementary DNA sequences below from an E. coli gene promoter region, match the following labels to the appropriate strand. ACGTGTAACTGTTAATCTAGTACAGCTACATATTAGTGAGATAAT 1. Non- template TGCACATTGACAATTAGATCATGTCGATGTATAATCACTCTATTA 2. Template

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT