Homework Answers
Add Answer to:
Incorrect Question 18 0/1 pts Which of the following dipeptides would result from partial hydrolysis of...
1. Partial hydrolysis of lysozyme yielded an octapeptide that was later identified as the N-terminal segment of...
1. Partial hydrolysis of lysozyme yielded an octapeptide that was later identified as the N-terminal segment of the protein. From the following information, determine the sequence of this octapeptide. a. The following amino acids were identified after complete hydrolysis of the octapeptide: Arginine (Arg) Glycine (Gly) Phenylalanine (Phe) Cysteine (Cys) Leucine (Leu) Valine (Val) Glutamic Acid (Glu) Lysine (Lys) b. Treatment of the octapeptide with dinitroflurobenzene (Sanger reagent) followed by complete hydrolysis gave lysine (Lys) labeled with two dinitrophenyl (DNP) groups. c. Treatment of the octapeptide with trypsin gave lysine...
1. Partial hydrolysis of lysozyme yielded an octapeptide that was later identified as the N-terminal segment of...
1. Partial hydrolysis of lysozyme yielded an octapeptide that was later identified as the N-terminal segment of the protein. From the following information, determine the sequence of this octapeptide. a. The following amino acids were identified after complete hydrolysis of the octapeptide: Arginine (Arg) Glycine (Gly) Phenylalanine (Phe) Cysteine (Cys) Leucine (Leu) Valine (Val) Glutamic Acid (Glu) Lysine (Lys) b. Treatment of the octapeptide with dinitroflurobenzene (Sanger reagent) followed by complete hydrolysis gave lysine (Lys) labeled with two dinitrophenyl (DNP) groups. c. Treatment of the octapeptide with trypsin gave lysine...
Which dipetides would be produced from the partial hydrolysis of His-Met-Gly-Val?
Which dipetides would be produced from the partial hydrolysis of His-Met-Gly-Val?
What fragments will be obtained by a trypsin hydrolysis of the following octapeptide? Ala-Val-Trp-Lys-Phe-Gly-Arg-Met A) Ala-Val-Trp-Lys-Phe...
What fragments will be obtained by a trypsin hydrolysis of the following octapeptide? Ala-Val-Trp-Lys-Phe-Gly-Arg-Met A) Ala-Val-Trp-Lys-Phe and Gly-Arg-Met 3) Ala-Val-Trp-Lys-Phe-Gly and Arg-Met - Ala-Val-Trp-Lys and Phe-Gly-Arg and Met ) Ala-Val-Trp-Lys and Phe and Gly-Arg and Met ) Ala-Val-Trp and Lys-Phe-Gly and Arg-Met Bradykinin is a nonapeptide, Arg-Pro-Pro-Gly-Phe-Ser-Pro-Phe-Arg. In addition to one mole of Arg, what peptides are present after hydrolysis of bradykinin with chymotrypsin? A) Arg-Pro-Pro and Gly-Phe and Ser-Pro-Phe B) Pro-Pro-Gly and Phe-Ser-Pro-Phe-Arg C) Arg-Pro-Pro-Gly-Phe and Ser-Pro-Phe ?) Arg-Pro-Pro-Gly-Phe-Ser...
Which one is the major product of the following reaction sequence? NH 1. excess CHI 2....
Which one is the major product of the following reaction sequence? NH 1. excess CHI 2. Ag,0,H,O heat A decapeptide that is part of an insulin-like peptide has the molecular formula: Gly, Asp(2), Arg, Ser, Phe, Cys(2), Val(2). After partial hydrolysis, the fragments are: Val-Asp-Ser Asp-Phe-Arg-Gly Ser-Cys-Cys Gly-Val-Val What is the sequence? Gly-Val-Val-Asp-Ser-Cys-Cys-Asp-Phe-Arg Asp-Phe-Arg-Gly-Val-Val-Asp-Ser-Cys-Cys Asp-Cys-Cys Arg-Gly-Val-Val-Phe-Arg-Gly Val-Asp-Ser-Cys-Cys-Asp-Phe-Arg-Gly-Val Which aldehyde or ketone AND amine reactants are needed to complete the following reaction? Amine N.BH CN dil H,09 NH(CH3 NH(CH3 NICH) (CH2)...
. Insulin (below) is treated with dansyl chloride followed by its complete acidic hydrolysis. Which of the following da...
. Insulin (below) is treated with dansyl chloride followed by its complete acidic hydrolysis. Which of the following dansylated amino acids you expect to observe? A chain Gly-Ile-Val-Glu-Gln-Cys-Cys- Ala-Ser-Val - Cys-Ser-Leu- Tyr-Gln-Leu-Glu-Asn - Tyr-Cys- Asn 10 15 21 B chain Phe-Val - Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val-Glu - Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu-Arg-Gly-Phe-Phe-Tyr-Thr-Pro-Lys - Ala 10 20 25 30 15
For the following DNA strand, what is the amino acid chain that would result in the cell?
For the following DNA strand, what is the amino acid chain that would result in the cell? CGGTTATCTAAAGTACACTATCATGGC Arg - leu - ser-lys - val - his - tyr-his-gly Ala - asn- - arg - phe - his - val - ile - val - pro met - ile -val - tyr - phe - arg Ala-met-ile-val-tyr - phe - arg - pro
Question 5 Bio206 Homework 6 Amino Acids and Proteins Organic Chemistry II Due May 6, 2017 1. Which amino acid is least likely to be found in a natural protein? CH20H NHz CHs IV 2. A pentapeptide has...
Question 5
Bio206 Homework 6 Amino Acids and Proteins Organic Chemistry II Due May 6, 2017 1. Which amino acid is least likely to be found in a natural protein? CH20H NHz CHs IV 2. A pentapeptide has the molecular formula: Asp, Glu, His, Phe, Val. Partial hydrolysis of the pentapeptide gives: Val Asp, Glu His, Phe Val, and Asp Glu. What is the amino acid sequence of the pentapeptide? 3. When the pentapeptide below is heated first with 2,4-dinitrofluorobenzene...
Incorrect Question 6 0/1 pts The sequence N-Met-Asp-Val-Gly-His-Gly-Arg-Thr-C is an example of the primary structure of...
Incorrect Question 6 0/1 pts The sequence N-Met-Asp-Val-Gly-His-Gly-Arg-Thr-C is an example of the primary structure of a protein. secondary structure of a protein. tertiary structure of a protein. quaternary structure of a protein. Incorrect!
question 2 de 6 out of a maximum of 10 (60%) A complete turn of the...
question 2
de 6 out of a maximum of 10 (60%) A complete turn of the A-DNA helix occurs at which distance? Choose one answer. . .O.Od A. 33 A B. 10 A C. 29 A D4A Incorrect Marks for this submission: 0/1. A pentapeptide has the following proportions of amino acids: gly (1), leu (1),val (1), phe (2). Treatment of the pentapeptide with chymotrypsin gave the following fragments: gly-val, leu, phe. Which is the structure of the pentapeptide? Choose...
What fragments will be obtained by a trypsin hydrolysis of the following octapeptide? Ala-Val-Trp-Lys-Phe-Gly-Arg-Met A) Ala-Val-Trp-Lys-Phe and Gly-Arg-Met 3) Ala-Val-Trp-Lys-Phe-Gly and Arg-Met - Ala-Val-Trp-Lys and Phe-Gly-Arg and Met ) Ala-Val-Trp-Lys and Phe and Gly-Arg and Met ) Ala-Val-Trp and Lys-Phe-Gly and Arg-Met Bradykinin is a nonapeptide, Arg-Pro-Pro-Gly-Phe-Ser-Pro-Phe-Arg. In addition to one mole of Arg, what peptides are present after hydrolysis of bradykinin with chymotrypsin? A) Arg-Pro-Pro and Gly-Phe and Ser-Pro-Phe B) Pro-Pro-Gly and Phe-Ser-Pro-Phe-Arg C) Arg-Pro-Pro-Gly-Phe and Ser-Pro-Phe ?) Arg-Pro-Pro-Gly-Phe-Ser...
Which one is the major product of the following reaction sequence? NH 1. excess CHI 2. Ag,0,H,O heat A decapeptide that is part of an insulin-like peptide has the molecular formula: Gly, Asp(2), Arg, Ser, Phe, Cys(2), Val(2). After partial hydrolysis, the fragments are: Val-Asp-Ser Asp-Phe-Arg-Gly Ser-Cys-Cys Gly-Val-Val What is the sequence? Gly-Val-Val-Asp-Ser-Cys-Cys-Asp-Phe-Arg Asp-Phe-Arg-Gly-Val-Val-Asp-Ser-Cys-Cys Asp-Cys-Cys Arg-Gly-Val-Val-Phe-Arg-Gly Val-Asp-Ser-Cys-Cys-Asp-Phe-Arg-Gly-Val Which aldehyde or ketone AND amine reactants are needed to complete the following reaction? Amine N.BH CN dil H,09 NH(CH3 NH(CH3 NICH) (CH2)...
. Insulin (below) is treated with dansyl chloride followed by its complete acidic hydrolysis. Which of the following dansylated amino acids you expect to observe? A chain Gly-Ile-Val-Glu-Gln-Cys-Cys- Ala-Ser-Val - Cys-Ser-Leu- Tyr-Gln-Leu-Glu-Asn - Tyr-Cys- Asn 10 15 21 B chain Phe-Val - Asn-Gln-His-Leu-Cys-Gly-Ser-His-Leu-Val-Glu - Ala-Leu-Tyr-Leu-Val-Cys-Gly-Glu-Arg-Gly-Phe-Phe-Tyr-Thr-Pro-Lys - Ala 10 20 25 30 15
For the following DNA strand, what is the amino acid chain that would result in the cell? CGGTTATCTAAAGTACACTATCATGGC Arg - leu - ser-lys - val - his - tyr-his-gly Ala - asn- - arg - phe - his - val - ile - val - pro met - ile -val - tyr - phe - arg Ala-met-ile-val-tyr - phe - arg - pro
Question 5
Bio206 Homework 6 Amino Acids and Proteins Organic Chemistry II Due May 6, 2017 1. Which amino acid is least likely to be found in a natural protein? CH20H NHz CHs IV 2. A pentapeptide has the molecular formula: Asp, Glu, His, Phe, Val. Partial hydrolysis of the pentapeptide gives: Val Asp, Glu His, Phe Val, and Asp Glu. What is the amino acid sequence of the pentapeptide? 3. When the pentapeptide below is heated first with 2,4-dinitrofluorobenzene...
Incorrect Question 6 0/1 pts The sequence N-Met-Asp-Val-Gly-His-Gly-Arg-Thr-C is an example of the primary structure of a protein. secondary structure of a protein. tertiary structure of a protein. quaternary structure of a protein. Incorrect!
question 2
de 6 out of a maximum of 10 (60%) A complete turn of the A-DNA helix occurs at which distance? Choose one answer. . .O.Od A. 33 A B. 10 A C. 29 A D4A Incorrect Marks for this submission: 0/1. A pentapeptide has the following proportions of amino acids: gly (1), leu (1),val (1), phe (2). Treatment of the pentapeptide with chymotrypsin gave the following fragments: gly-val, leu, phe. Which is the structure of the pentapeptide? Choose...
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago