Write code in a Python, that checks a source file (input file in plain text format) that separates lexemes by white space and special characters. This lexical analyzer will only have tokens for special characters and alphanumeric strings.
le: 2345 6tgbsauhd9sa67*I{OPKDSI;jakihl
Would be 2345
6tgbsauhd9sa67
*
l
{
OPKDSI
;
jakihl
Code:
import string
SPL_CHAR = string.punctuation
f = open("data.txt", "r") #opening file in read mode
for line in f.readlines(): #read file line by line
word=""
line = line.rstrip() #to remove new line character
for c in line: #for each character in line
if c not in SPL_CHAR and c != " ":
word = word + c #append character to word if it isnot special
character or space
elif c == " ":
print(word) #print word if it is space
word="" #initialize it to empty string
else:
print(word) #if special character print word and the special
character
print(c)
word="" #initialize it to empty string
print(word) #print word when end of line

Output:
File Considered (data.txt)


Write code in a Python, that checks a source file (input file in plain text format)...
Write a complete Python program with prompts for the user for the main text file (checks that it exists, and if not, output an error message and stop), for any possible flags (including none), and for any other input that this program may need from the user: split has an option of naming the smaller files head_tail list the first 10 lines (default) and the last 10 lines (default) in order of the given text file flag: -# output #...
PYTHON The text file motifFinding.txt contains two strings of DNA code, separated by a new-line character. Write a program that opens the file, and stores its contents into two strings, s and t, respectively. Write code that will find all instances of the string t within the string s. At the end, your program should output the number of times the sub-string t occurs within s, along with the index of the starting position of each occurrence of t within...
PLEASE DO IT IN PYTHON, THANK YOU!
CSV file: This is a file containing plain text where each line in the file represents one record of information, and each piece of info in the record is separated by a single comma. Luckily the values won't ever contain commas themselves for this project. But they might start or end with non visible characters (e.g. space, tab). Thus, you must remove the leading and trailing spaces when you store the data in...
Write a Python program to read lines of text from a file. For each word (i.e, a group of characters separated by one or more whitespace characters), keep track of how many times that word appears in the file. In the end, print out the top twenty counts and the corresponding words for each count. Print each value and the corresponding words, in alphabetical order, on one line. Print this in reverse sorted order by word count. You can assume...
Python code
Write a program that will ask the user to input two strings, assign the strings to variables m and n If the first or second string is less than 10 characters, the program must output a warning message that the string is too short The program must join the strings m and n with the join function The output must be displayed. Please name the program and provide at least one code comment (10)
Please Do it In Java: Objectives: To Java programming language To understand the lexical analysis phase of program compilation Assignment: The first phase of compilation is called scanning or lexical analysis. This phase interprets the input program as a sequence of characters and produces a sequence of tokens, which will be used by the parser. Write a Java, program that implements a simple scanner for a source file given as a command-line argument. The format of the tokens is described...
Write a Python program that converts an input file in FASTA format, called "fasta.txt", to an output file in PHYLIP format called "phylip.txt". For example, if the input file contains: >human ACCGTTATAC CGATCTCGCA >chimp ACGGTTATAC CGTACGATCG >monkey ACCTCTATAC CGATCGATCC >gorilla ATCTATATAC CGATCGATCG Then the output file should be human ACCGTTATACCGATCTCGCA chimp ACGGTTATACCGTACGATCG monkey ACCTCTATACCGATCGATCC gorilla ATCTATATACCGATCGATCG FASTA format has a description (indicated with a '>') followed by 1 or more lines of a DNA sequence. PHYLIP format has a description...
1. Write a python program that reads a file and prints the letters in increasing order of frequency. Your program should convert entire input to lower case and only counts letters a-z. Special characters or spaces should not be counted. Each letter and it's occurrences should be listed on a separate line. 2. Test and verify your program and it's output. ---Please provide a code and a screenshot of the code and output. Thank you. ----
Linux & Unix Write a bash program to indent the code in a bash source file. Conditions: The source file will contain only printing characters, spaces, and newlines. It is not necessary to check for invalid input. The source file will not contain comments (words beginning with #). Requirements: Read from standard input, write to standard output. Code inside while statements should be indented 2 spaces. Be sure your program includes all of the following: ...
Create a python code named LetterCount with a text file named words.txt that contains at least 100 words in any format - some words on the same line, some alone (this program involves no writing so you should not be erasing this file). Then create a program in the main.py that prompts the user for a file name then iterates through all the letters in words.txt, counting the frequency of each letter, and then printing those numbers at the end...