Question

Question 5 3 pts Which amino acids would you find glycosylated in proteins (either N-linked or O-linked)? Asn Ser Thr Ala O His O Lys Arg Asp Glu

0 0
Add a comment Improve this question Transcribed image text
Know the answer?
Add Answer to:
Question 5 3 pts Which amino acids would you find glycosylated in proteins (either N-linked or...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА...

    What amino acid would the Manticodon code for RNA codon table 2nd position Tot position СТА Tyr Phe Phe > eu eu Oulaa Jooo 9999 stop stop eu eu eu Let 0 - puchbucobucusura BER < Val Val Asp Ala Asp Ala Glu Ala Glu Amino Acids Keu Pro Pro His Weu Leu Gin lle Pro Thr Thr Thr Thr Asn Asn lle Ser Ser Arg lle Met Lys Lys bucoucouco Arg > Asp Asp Val Val Val Val Ala...

  • Question Completion Status: O Tryptophan and tyrosine QUESTION 2 2 points Save Answer Which of the...

    Question Completion Status: O Tryptophan and tyrosine QUESTION 2 2 points Save Answer Which of the following stretches of amino acid residues would you expect to find in the interior of protein molecules? O Gly-Tyr-His-Arg-His O Ala-Val-Leu-lle-Trp O Ala-Asp-Asp-Tyr-Arg O Gly-Lys-Ser-Pro-Thr OPhe-Glu-Gin-Glu-Asn QUESTION 3 2 points Save Answer The observation that proteins often renature into their original conformations after

  • 3. A protein contains the following amino acids: O ALA 4 GLN 1 LEU 3 ARG...

    3. A protein contains the following amino acids: O ALA 4 GLN 1 LEU 3 ARG 4 GLU 4 LYS 4 ASN 5 GLY O MET 1 ASP 1 HIS 2 PHE 4 ILE 4 PRO 8 SER 5 THR 1 TRP 2 TYR 2 VAL BGYS. a) What is its net charge at pH 1? b) What is its net charge at PH 13? c) Calculate the pl. 4. In what order would the amino acids GLU, LYS, and...

  • What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on y...

    What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on your protein? Here is the vector: T7 promoter lac operator Xbal rbs Ndel AATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCCT Met Ser Pro GST Ta His TagSacl ATACTAGGTTAT.627bp...GACCATCCTCCAAAATCGGATGGTTCAACTAGTGGTTCTGGTCATCACCATCACCATCACTCCGCGGGTCTGGTGCCACGCGGTAGT lle Leu Gly Tyr.. .209aa. . . Asp His Pro Pro Lys Ser Asp Gly Ser Thr Ser Gly Ser Gly His His...

  • Suppose part of the amino acid sequence of a protein is N... Gly - Ala -...

    Suppose part of the amino acid sequence of a protein is N... Gly - Ala - Pro - Arg - Lys ...C. Which of the following amino acid sequences could result from a frameshift mutation (+1 or -1) in the part of the gene that encodes this sequence of amino acids? Ο N... Gly - Ala - Asn - Ser - Leu ...C Ο Ν...Αla - Ala - Arg - Pro - Lys...C Ο Ν...Gly - Gly - Thr -...

  • How many amino acids are there in the disease causing variant of the Amyloid-beta (Ab) peptide?...

    How many amino acids are there in the disease causing variant of the Amyloid-beta (Ab) peptide? Determine which of these four peptides is most likely to become a beta sheet. Lys-Thr-Val-Ile-Trp-Pro-Phe-Tyr-Ile-Gln-Ile-Gly Arg-Ser-Tyr-Glu-Gly-Leu-Lys-Arg-Ile-Ala-Glu-Ser Ala-Glu-Met-Leu-Gln-Lys-Arg-Gly-Cys-Gly-Asp-Glu Met-Leu-Lys-Ala-Ser-Ala-Leu-Glu-Lys-Leu-Ser-Glu

  • repulsion within the protein 10. Which of the following amino acids do not contain a chiral...

    repulsion within the protein 10. Which of the following amino acids do not contain a chiral carbon? a. Proline b. Alanine c. Glycine d. Phenylalanine e. Tyrosine 11. You want to determine an amino acid sequence for a particular polypeptide. So you degrade the peptid and get the following fragments. Determine the peptide sequence. Digested with typsin: Met-Val-Ser-Thr-Lys Val-lle-Trp-Thr-Leu-Met-lle Leu-Phe-Asn-Glu-Ser-Arg Digested with chymotrypsin: Asn-Glu-Ser-Arg-Val-lle-Trp Thr-Leu-Met-lle Met-Val-Ser-Thr-Lys-Leu-Phe a. Val-lle-Trp-Thr-Leu-Met-lle-Leu-Phe-Asn-Glu-Ser-Arg-Met-Val-Ser-Thr-Lys b. Val-lle-Trp-Thr-Leu-Met-lle-Met-Val-Ser-Thr-Lys-Leu-Phe-Asn-Glu-Ser-Arg c. Leu-Phe-Asn-Glu-Ser-Arg-Met-Val-Ser-Thr-Lys-Val-lle-Trp-Thr-Leu-Met-le d. Met-Val-Ser-Thr-Lys-Leu-Phe-Asn-Glu-Ser-Arg-Val-le-Trp-Thr-Leu-Met-lle e. Met-Val-Ser-Thr-Lys-Val-lle-Trp-Thr-Leu-Met-lle-Leu-Phe-Asn-Glu-Ser-Arg

  • Incorrect Question 10 0/2 pts What will the polypeptide sequence be from the following DNA template...

    Incorrect Question 10 0/2 pts What will the polypeptide sequence be from the following DNA template strand? 3' CATGTACGCATTGAGAACTCGC 5' Asp-His-Ala-Stop-Leu-Leu-Ser Met-Arg-Asn-Ser Met-Arg-Asn-Ser-Ala Met-Tyr-Ala-Leu-Arg-Thr-Arg Asp-His-Ala-Leu-Leu-Ser Asp-His-Ala His-Val-Arg-Ile-Glu-Asn-Ser Met-Arg-Asn-Ser-Stop-Ala Check the orientation of the strands. How do you know which reading frame to use?

  • Met-Ala-Arg-Tyr-Ala-Asn-Asn-Glu__Lys-Glu-Leu-Leu-Tyr__Arg-Tyr-Ala-Asn__Phe-Leu-Ala-Asn-Asn-Ile-Gly-Ala-Asn__Ile-Ser__Ile-Asn-Thr-Glu-Arg-Glu-Ser-Thr-Glu-Asp__Ile-Asn__ His-Glu-Arg__Phe-Ala-Thr-His-Glu-Arg-Ser__Thr-Arg-Ile-Gly-Leu-Tyr-Cys-Glu-Arg-Ile-Asp-

    Met-Ala-Arg-Tyr-Ala-Asn-Asn-Glu__Lys-Glu-Leu-Leu-Tyr__Arg-Tyr-Ala-Asn__Phe-Leu-Ala-Asn-Asn-Ile-Gly-Ala-Asn__Ile-Ser__Ile-Asn-Thr-Glu-Arg-Glu-Ser-Thr-Glu-Asp__Ile-Asn__ His-Glu-Arg__Phe-Ala-Thr-His-Glu-Arg-Ser__Thr-Arg-Ile-Gly-Leu-Tyr-Cys-Glu-Arg-Ile-Asp-Glu__Leu-Glu-Val-Glu-Leu-Ser__Ser-Ile-Asn-Cys-Glu__His-Glu-__His-Ala-Pro-Pro-Ile-Leu-Tyr__Glu-Ala-Thr-Ser__Val-Ala-Asn-Ile-Leu-Leu-Ala__Cys-Ala-Lys-Glu-__Ala-Asn-Asp__Pro-Glu-Cys-Ala-Asn__Pro-Ile-Glu__Trp-Ile-Thr-His__Phe-Arg-Ile-Glu-Asp__Cys-His-Glu-Glu-Ser-Glu-Cys-Ala-Lys-Glu__Ile-Cys-Glu__Cys-Arg-Glu-Ala-Met__Glu-Val-Glu-Arg-Tyr-Asp-Ala-Tyr__Ala-Asn-Asp__Ser-His-Glu__Ile-Ser__Asp-Glu-Val-Ala-Ser-Thr-Ala-Thr-Glu-Asp__Thr-His-Ala-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu-Ser__Leu-Ile-Lys-Glu__His-Glu-Ala-Arg-Thr__Asp-Ile-Ser-Glu-Ala-Ser-Glu__Ser-Leu-Glu-Glu-Pro__Ala-Pro-Asn-Glu-Ala__Ser-Glu-Val-Glu-Arg-Glu__Trp-Glu-Ile-Gly-His-Thr__Gly-Ala-Ile-Asn__Trp-Ile-Leu-Leu__Ala-Arg-Ile-Ser-Glu__Ile-Phe__His-Glu__Lys-Glu-Glu-Pro-Ser__Thr-His-Ile-Ser__Glu-Ala-Thr-Ile-Asn-Gly__Pro-Ala-Thr-Thr-Glu-Arg-Asn__Tyr-Glu-Thr__Ile-Phe__His-Glu__Trp-Trp-Trp-Trp-Ile-Ile-Ile-Ile-Ile-Leu-Leu-Leu-Leu-Leu-Ser-Ser-Ser-Ser__Cys-His-Ala-Asn-Gly-Glu__Ile-Asn__His-Ile-Ser__Leu-Ile-Phe-Glu-Ser-Thr-Tyr-Leu-Glu__His-Glu__Cys-Ala-Asn__Ser-Thr-Ile-Leu-Leu__Arg-Glu-Met-Ala-Ile-Asn__His-Glu-Ala-Leu-Thr-His-Tyr__Ser-Ala-Ser-Ser-Tyr__Ala-Asn-Asp__Ala-Leu-Arg-IleGly-His-Thr 1.) Write out the 1 letter amino acid abbreviation for each of the three-letter amino acid abbreviated words listed in the given sequence. The __ indicates a space in between the words. Use www.expasy.org and other bioinformatic tools to generate the following bioinformatic data for the given polypeptide sequence. You must give the name and link to the program you used to generate the data: 2.) Compute the pI and Mw (isoelectric point and molecular mass, respectively) of...

  • Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein...

    Table 1: Partial RPE65 protein sequence (amino acids 41-60) for the 9-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Ser-Leu-Leu-Arg-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP START...Ser-Leu-Leu-Gin-Cyc-Gly-Pro-Gly-Leu-Phe-Glu-Val-Gly-Ser-Glu-Pro-Phe-Tyr- His-Gly...STOP Table 2. Partial RPE65 protein sequence (amino acids 61-70 and 291–300) for the 11-year-old LCA patient. Unmutated Protein Sequence Patient's Allele 1 Protein Sequence Patient's Allele 2 Protein Sequence START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-Tyr-Lys-Phe...lle-Ala-Asp-Lys-Lys-Arg-Lys-Lys- Tyr-Leu...STOP START...Phe-Asp-Gly-Gln-Ala-Leu-Leu-His-Lys-Phe...lle-Ala-Asp-Lys-STOP Source: Data from Russell et al. (2017). Use Tables 1 and 2 to...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT