| Amino acid | Functional group | Polarity | pKa | Charge at pH=7 | Special properties |
| Alanine | Carboxyl, Amino | Non polar | 2.35 (carboxyl), 9.69 (Amino) | No charge | Optically active, Ambivalent |
| Arginine | Carboxyl, Amino | Polar | 12.48 | Positive | Has important role in nitrogen metabolism |
| Asparagine | Carboxyl, Amino | Polar | 2.02 (carboxyl), 8.80 (Amino) | No charge | Used in biosynthesis of protein |
| Aspartet | Important enzyme in amino acid metabolism | ||||
| Cysteine | |||||
| Glutamine | Carboxyl, Amino | Polar | 2.2 (carboxyl), 9.1 (Amino) | No charge | Used in biosynthesis of protein |
| Glutamet | Carboxyl | Polar | NA | Negative | Neurotransmitter |
| Glycine | Carboxyl, Amino | 2.34 (carboxyl), 9.6 (Amino) | No charge | Proteinogenic | |
| Histidine | Carboxyl, Amino, Immidazole side chain | Polar | NA | Positive | Inflametory agent |
| Isoleucine | Carboxyl, Amino | Non polar | NA | No charge | Used in biosynthesis of protein |
| Leucine | Carboxyl,Amino | Non polar | NA | No charge | Branched chein amino acid |
| Lysine | Carboxyl, Amino | Polar | NA | Positive | Used in biosynthesis of protein |
| Methionine | Carboxyl, Amino | Non polar | 2.28(carboxyl), 9.21 (Amino) | No charge | Related to cancer growth |
| Phenylalanine | Carboxyl, Amino | Non polar | 1.83 (carboxyl), 9.13 (Amino) | No charge | Treat depression |
| Proline | Carboxyl, Amino | Non polar | 1.99 (carboxyl), 10.96 (Amino) | No charge | Important role in intracellular signaling |
| Serine | Carboxyl, Amino | Polar | 2.21 (carboxyl), 9.15 (Amino) | No charge | Proper functioning of brain & CNS |
| Threonine | Carboxyl, Amino, Hydroxyl | Polar | 2.63 (carboxyl), 10.43 (Amino) | No charge | Vital in protein synthesis |
| Tryptophane | Carboxyl, Amino | Non polar | 2.38 (carboxyl), 9.39 (Amino) | No charge | Building blocks of protein synthesis |
| Tyrosine | Phenol | Non polar | NA | No charge | Neurotransmitter |
| Valine | Carboxyl, Amino | Non polar | 2.32 (carboxyl), 9.62 (Amino) | No charge | Has stimulant effect |
Fill in the blanks for each amino acid Amino Acid Properties Name of R-group Properties Amino...
options
There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The C-terminal amino acid is Choose... V NH3 NHE ОН 90- NH Choose... glycine alanine valine leucine isoleucine serine threonine cysteine methonine aspartate glutamate asparagine glutamine lysine arginine phenylalanine tyrosine proline histidine
There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The C-terminal amino acid is Choose... V NH₃ NH₃ Air ОН 90- NH Choose... glycine alanine valine leucine isoleucine serine threonine cysteine methonine aspartate glutamate asparagine glutamine lysine arginine phenylalanine tyrosine proline histidine
Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...
B) If this mRNA is translated beginning with the
first AUG codon in its sequence, what is the N-terminal
amino acid sequence of the protein that it encodes?
can you help me solve A and B
The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...
table:
The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...
i think it might be Glutamate, but im not sure.
Someone please help!! its the last question i need to
finish this mindtap.
please respond quickly too, its due TODAY at 11:59pm
EST
CENGAGE MINDTAP a se Chapter 9 Digging Deeper Conceptual Learning Activity Second base U C A G UUU Phenylalanine UCU UUC Phenylalanine UCC Leucine UCA Leucine UCG Leucine CCU Leucine CCC Leucine CCA Leucine CCG Isoleucine ACU Isoleucine ACC Isoleucine ACA Methionine ACG Cysteine U Cysteine C...
What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND POSITION с A U phenyl- alanine tyrosine cysteine U serine U с A leucine stop stop tryptophan stop G histidine U с A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G U isoleucine asparagine serine A threonine A lysine arginine methionine G U с A valine G aspartic acid glutamic acid alanine glycine and start Cysteine Alanine Arginine Serine
The one-letter sequence is: WATER
a) Draw the peptide (R-groups trans), indicating charges, in
predominant form found at pH = 0.
b) What is the isoelectric point?
c) What is the average charge on the population of peptide
macromolecules at pH = 2.2?
d) What is the average charge on the population of peptide
macromolecules at pH = 12.5?
TABLE 4.1 Amino Acid Alanine Arginine Asparagine Aspartic acid Cysteine....« Glutamic acid Glutamine Glycine Histidine Isoleucine Leucine Lysine … Methionine Phenylalanine...
You are given the below piece of Template DNA. What is the third amino acid in the protein encoded by this gene? 3'A ATACGGGGAGCTTTACAGAATTCAAATCAS' SECOND POSITION с A U phenyl- alanine tyrosine cysteine U U с A serine leucine stop stop stop tryptophan G histidine U с А с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G isoleucine asparagine serine U с А A threonine lysine arginine methionine G U valine slanine aspartic acid glutamic acid glycine А G...
Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala) chou GU Tyrosine (Tyr) A с A Valine (Val) G U Cysteine (Cys) U G START HERE Typtophan (Trp) Arginine (Arg) A G U с A с Leucine (Leu) Serine (Ser) A с UGA Proline (Pro) Lysine (Lys) Asparagine (AST) Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon The anticodon for CCA is...