Question
Fill in the blanks for each amino acid

Amino Acid Properties Name of R-group Properties Amino Acid Type of Polarity pKa Charge at Special functional group pH-7 Properties (hn(wpp)amgies applicable) (whpee Alanine Arginine Asparagine Aspartate Carboxyl Polar 3.9 Sulfhydryl Polar N/A Forms S-S Glutamine Glutamate Histidine Isoleucine Lysine Methionine Phenylalanine Aromatic Non-Polar Absorbs G@ 280 nm N/A Proline Can be Serine Threonine Tryptophane Tyrosine Valine
0 0
Add a comment Improve this question Transcribed image text
Answer #1
Amino acid Functional group Polarity pKa Charge at pH=7 Special properties
Alanine Carboxyl, Amino Non polar 2.35 (carboxyl), 9.69 (Amino) No charge Optically active, Ambivalent
Arginine Carboxyl, Amino Polar 12.48 Positive Has important role in nitrogen metabolism
Asparagine Carboxyl, Amino Polar 2.02 (carboxyl), 8.80 (Amino) No charge Used in biosynthesis of protein
Aspartet Important enzyme in amino acid metabolism
Cysteine
Glutamine Carboxyl, Amino Polar 2.2 (carboxyl), 9.1 (Amino) No charge Used in biosynthesis of protein
Glutamet Carboxyl Polar NA Negative Neurotransmitter
Glycine Carboxyl, Amino 2.34 (carboxyl), 9.6 (Amino) No charge Proteinogenic
Histidine Carboxyl, Amino, Immidazole side chain Polar NA Positive Inflametory agent
Isoleucine Carboxyl, Amino Non polar NA No charge Used in biosynthesis of protein
Leucine Carboxyl,Amino Non polar NA No charge Branched chein amino acid
Lysine Carboxyl, Amino Polar NA Positive Used in biosynthesis of protein
Methionine Carboxyl, Amino Non polar 2.28(carboxyl), 9.21 (Amino) No charge Related to cancer growth
Phenylalanine Carboxyl, Amino Non polar 1.83 (carboxyl), 9.13 (Amino) No charge Treat depression
Proline Carboxyl, Amino Non polar 1.99 (carboxyl), 10.96 (Amino) No charge Important role in intracellular signaling
Serine Carboxyl, Amino Polar 2.21 (carboxyl), 9.15 (Amino) No charge Proper functioning of brain & CNS
Threonine Carboxyl, Amino, Hydroxyl Polar 2.63 (carboxyl), 10.43 (Amino) No charge Vital in protein synthesis
Tryptophane Carboxyl, Amino Non polar 2.38 (carboxyl), 9.39 (Amino) No charge Building blocks of protein synthesis
Tyrosine Phenol Non polar NA No charge Neurotransmitter
Valine Carboxyl, Amino Non polar 2.32 (carboxyl), 9.62 (Amino) No charge Has stimulant effect
Add a comment
Know the answer?
Add Answer to:
Fill in the blanks for each amino acid Amino Acid Properties Name of R-group Properties Amino...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • options There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The...

    options There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The C-terminal amino acid is Choose... V NH3 NHE ОН 90- NH Choose... glycine alanine valine leucine isoleucine serine threonine cysteine methonine aspartate glutamate asparagine glutamine lysine arginine phenylalanine tyrosine proline histidine

  • There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The C-terminal...

    There are peptide bonds in the molecule below. The N-terminal amino acid is Choose... The C-terminal amino acid is Choose... V NH₃ NH₃ Air ОН 90- NH Choose... glycine alanine valine leucine isoleucine serine threonine cysteine methonine aspartate glutamate asparagine glutamine lysine arginine phenylalanine tyrosine proline histidine

  • Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three...

    Translation: find the start codon AUG on the mRNA below, underline nucleotides in sets of three (codons), find the appropriate amino acid for each codon in the chart below, and stop when you come to a stop codon. Translate the following mRNA. AACACCAUGACCUACAUAGGGAGGGACUUAGUAGCGGAGGGGUGAUCAUUA The genetic code UUU phenylalanine UCU serine UAU tyrosine UGU cysteine UUC phenylalanine UCC serine UAC tyrosine UGC cysteine UUA leucine UCA serine UAA STOP UGA STOP UUG leucine UCG serine UAG STOP UGG tryptophan CUU leucine...

  • B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is...

    B)  If this mRNA is translated beginning with the first AUG codon in its sequence, what is the N-terminal amino acid sequence of the protein that it encodes? can you help me solve A and B The 5'-end of an mRNA has the sequence: ...GUCCCAUUGAUGCAUGAAUCAUAUGGCAGAGCCCGCUGG... a What is the nucleotide sequence of the DNA template strand from which it was transcribed? The Standard Genetic Code AAA Lysine CAA Glutamine GAA Glutamate UAA stop AAC Asparagine CAC | Histidine GAC Aspartate UAC...

  • table: The DNA sequence shown below is part of a eukaryotic gene. Note that there are...

    table: The DNA sequence shown below is part of a eukaryotic gene. Note that there are no introns in this part of the gene, The top DNA strand is the template for RNA polymerase. Answer the following questions - feel free to use your notes, book and discuss with each other. Your answers are due WEDNESDAY 3/25/2020 at 11:50 pm. 5'-ATGGCAGCTAAACACTTTTAAAATA-3' (template strand) 3'-TACCGTCGATTTGTGAAAATTTTAT-5 1. What direction does RNA polymerase READ its template? 2. What is the sequence of the...

  • i think it might be Glutamate, but im not sure. Someone please help!! its the last...

    i think it might be Glutamate, but im not sure. Someone please help!! its the last question i need to finish this mindtap. please respond quickly too, its due TODAY at 11:59pm EST CENGAGE MINDTAP a se Chapter 9 Digging Deeper Conceptual Learning Activity Second base U C A G UUU Phenylalanine UCU UUC Phenylalanine UCC Leucine UCA Leucine UCG Leucine CCU Leucine CCC Leucine CCA Leucine CCG Isoleucine ACU Isoleucine ACC Isoleucine ACA Methionine ACG Cysteine U Cysteine C...

  • What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND...

    What amino acid is attached to a tRNA with the following anticodon: 5' GCA 3'? SECOND POSITION с A U phenyl- alanine tyrosine cysteine U serine U с A leucine stop stop tryptophan stop G histidine U с A с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G U isoleucine asparagine serine A threonine A lysine arginine methionine G U с A valine G aspartic acid glutamic acid alanine glycine and start Cysteine Alanine Arginine Serine

  • The one-letter sequence is: WATER a) Draw the peptide (R-groups trans), indicating charges, in pr...

    The one-letter sequence is: WATER a) Draw the peptide (R-groups trans), indicating charges, in predominant form found at pH = 0. b) What is the isoelectric point? c) What is the average charge on the population of peptide macromolecules at pH = 2.2? d) What is the average charge on the population of peptide macromolecules at pH = 12.5? TABLE 4.1 Amino Acid Alanine Arginine Asparagine Aspartic acid Cysteine....« Glutamic acid Glutamine Glycine Histidine Isoleucine Leucine Lysine … Methionine Phenylalanine...

  • You are given the below piece of Template DNA. What is the third amino acid in...

    You are given the below piece of Template DNA. What is the third amino acid in the protein encoded by this gene? 3'A ATACGGGGAGCTTTACAGAATTCAAATCAS' SECOND POSITION с A U phenyl- alanine tyrosine cysteine U U с A serine leucine stop stop stop tryptophan G histidine U с А с leucine proline arginine FIRST POSITION glutamine THIRD POSITION G isoleucine asparagine serine U с А A threonine lysine arginine methionine G U valine slanine aspartic acid glutamic acid glycine А G...

  • Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala)...

    Glycine (Gly) (Glu) Glutamic acid Phenylalanine (Phe) Leucine (Leu) (Asp) Aspartic acid Serine (Ser) Alanine (Ala) chou GU Tyrosine (Tyr) A с A Valine (Val) G U Cysteine (Cys) U G START HERE Typtophan (Trp) Arginine (Arg) A G U с A с Leucine (Leu) Serine (Ser) A с UGA Proline (Pro) Lysine (Lys) Asparagine (AST) Threonine (Thr) Methionine (Met) Isoleucine (lle) Arginine (Arg) Glutamine (Gin) Histidine (His) Кеу - Start codon - Stop codon The anticodon for CCA is...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT