Question

Problem of searching. Define it ad consider the game of missionaries and cannibals 5 missionaries, 4 cannibals, and 3 boats o

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Searching is the universal technique of problem solving in AI. There are some single-player games such as tile games, Sudoku, crossword, etc.

we have 5 missionaries(m),4 cannibals(c),3 boats(b)

there will be two banks one is left side and right side.

the conditions are:

1)the number of missionaries in the boat should be more than the cannibals if nor then the cannibals will eat the missionaries.

when the boat is returning there should be one either missionarie or cannibals.

sloution:

1) our target is right side bank and we have to travel from the left side.

2)firstly, In first boat should have 3 missionaries and 2 cannibals

and in the second boat should have 2 missionaries

and in the third boat should have 2 cannibals

=>so that all the missinoaries and cannibals reach to the right side.

Add a comment
Know the answer?
Add Answer to:
Problem of searching. Define it ad consider the game of missionaries and cannibals 5 missionaries, 4...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Consider a game of tennis from deuce onward. Starting at the state of deuce, if the server wins, the score is ad-in. If...

    Consider a game of tennis from deuce onward. Starting at the state of deuce, if the server wins, the score is ad-in. If the server then loses the next point, the game is back to deuce. However, if the server wins two points in a row, he wins the game. Similarly, starting at the state of deuce, if the returner wins, the score is ad-out. If the returner then loses the next point, the game is back to deuce. But...

  • 4. Consider a game of ladder climbing. There are 5 levels in the game, level 1...

    4. Consider a game of ladder climbing. There are 5 levels in the game, level 1 is the lowest (bottom) and level 5 is the highest (top). A player starts at the bottom. Each time, a fair coin is tossed. If it turns up heads, the player moves up one level. If tails, the player moves down to the very bottom. Once at the top level, the player moves to the very bottom if a tail turns up, and stays...

  • 5) Game Theory (6 points) Suppose AT&T and T-Mobile are deciding whether to increase ad spending...

    5) Game Theory (6 points) Suppose AT&T and T-Mobile are deciding whether to increase ad spending to promote their 4G LTE networks. If both companies increase ad spending, they will each earn $2 million in profit. If both leave ad spending the same, they will each earn $3 million in total profit. If one firm increases spending and the other leaves theirs the same, the firm which increases spending will earn new customers and increase profits to $4 million, while...

  • A) Consider the extensive form game of complete and imperfect information above. The number of pure...

    A) Consider the extensive form game of complete and imperfect information above. The number of pure strategy Nash Equilibrium in the game is? (Please, type only numerical values, for example: 0, 1, 2, 3,....) B) Consider the extensive form game of complete and imperfect information above. The following strategy profiles are Subgame Perfect Nash Equilibrium (Select all that apply)    a) (WY, AD)    b) (WY, AC)    c) (ZX, AD)    d) (ZY, BC)    e) (ZY, BD)   ...

  • Consider the problem of searching for genes in DNA sequences. A DNA sequence is represented by...

    Consider the problem of searching for genes in DNA sequences. A DNA sequence is represented by a text on the alphabet A, C, G, T, and the gene or gene segment is the pattern. Pattern: TCCTATTCTT Text: TTATAGATCTCGTATTCTTTTATAGATCTCCTATTCTT Construct the table and a diagram of the FSM used by the KMP algorithm.

  • 5. Consider the Monty Hall Problem. A game show host shows you three doors, and indicates...

    5. Consider the Monty Hall Problem. A game show host shows you three doors, and indicates that one of them has a car behind it, while the other two have goats. You win a car if you end up choosing a door with a car behind it. The game is conducted as follows: • You pick an initial door out of the three available. • The game show hosts then opens a door (out of the remaining two doors) with...

  • Question 3 Searching Algorithms [12 marks (4 marks) Define a method that when passed an array...

    Question 3 Searching Algorithms [12 marks (4 marks) Define a method that when passed an array of integers arr and another integer target, returns the last index in arr where target exists and -1 if target isn't found in arr a. b. (4 marks) Provide a trace, in the form of a logic table, of running the following method for 1, 4, 4, 4, 5, 7, 8, 12, 12, 15, 16, 17, 35, 35, 35, 40 arr = target 14...

  • 4. Consider the following AD equation: t(mn a) What is the slope of this AD curve? b) What is the...

    4. Consider the following AD equation: t(mn a) What is the slope of this AD curve? b) What is the first time difference of the AD equation? 4. Consider the following AD equation: t(mn a) What is the slope of this AD curve? b) What is the first time difference of the AD equation?

  • Problem #4-Multiple Choice : Relating SSD to Design (2 points) A tow truck is searching a...

    Problem #4-Multiple Choice : Relating SSD to Design (2 points) A tow truck is searching a city street at 40 mph for illegally parked vehicles. It travels over an equal- tangent vertical curve with an initial grade of +40% and a final grade of 2.0%. If the height of the driver's eye is 6.0 ft and the driver spots a car 450 ft away with a height of 4.0 ft, what is the minimum length of the vertical curve. Include...

  • Problems 3,4 and 5 Problem 3. Consider the game below. (a) There are no dominant or...

    Problems 3,4 and 5 Problem 3. Consider the game below. (a) There are no dominant or dominated strategies. Is there anything you can say about what players will do? Player 2 C T (2,1) (0,2) M (1,1) (1,1)| (1,0) B(0,1) (2,0) (2,2) (0,3) Player (b) Report the best responses Problem 4. Bertrand Competition With Different Costs Suppose two firms facing a demand Dip) compete by setting prices simultaneously (Bertrand Competition). Firm 1 has a constant marginal cost e and Firm...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT