Question

Need some assistance coding this assembler exercise. I have included the test file. Thank you very...

Need some assistance coding this assembler exercise. I have included the test file. Thank you very much.

package sequencer;

import java.util.List;

public class Assembler {

   /**

   * Creates a new Assembler containing a list of fragments.

   *

   * The list is copied into this assembler so that the original list will not

   * be modified by the actions of this assembler.

   *

   * @param fragments

   */

   public Assembler(List<Fragment> fragments) {

   }

   /**

   * Returns the current list of fragments this assembler contains.

   *

   * @return the current list of fragments

   */

   public List<Fragment> getFragments() {

       return null;

   }

   /**

   * Attempts to perform a single assembly, returning true iff an assembly was

   * performed.

   *

   * This method chooses the best assembly possible, that is, it merges the

   * two fragments with the largest overlap, breaking ties between merged

   * fragments by choosing the shorter merged fragment.

   *

   * Merges must have an overlap of at least 1.

   *

   * After merging two fragments into a new fragment, the new fragment is

   * inserted into the list of fragments in this assembler, and the two

   * original fragments are removed from the list.

   *

   * @return true iff an assembly was performed

   */

   public boolean assembleOnce() {

       return false;

   }

   /**

   * Repeatedly assembles fragments until no more assembly can occur.

   */

   public void assembleAll() {

   }

}

AssemblerTest.java

package sequencer;

import static org.junit.Assert.*;

import java.util.ArrayList;
import java.util.Arrays;
import java.util.List;

import org.junit.Before;
import org.junit.Rule;
import org.junit.Test;
import org.junit.rules.Timeout;


public class AssemblerTest {
//   @Rule
//   public Timeout globalTimeout = Timeout.seconds(10); // 10 seconds
  
   private List<Fragment> one;
   private List<Fragment> two;
   private List<Fragment> three;
   private List<Fragment> dupFullOverlap;

   // This method is run before each test, performing initialization
   // on and of objects for the test.
   @Before
   public void setup() {
       one = new ArrayList<Fragment>();
       one.add(new Fragment("GCAT"));

       two = new ArrayList<Fragment>();
       two.add(new Fragment("CATG"));
       two.add(new Fragment("GCAT"));

       three = new ArrayList<Fragment>();
       three.add(new Fragment("ACTGTG"));
       three.add(new Fragment("ACACAC"));
       three.add(new Fragment("TGTGGG"));

       dupFullOverlap = new ArrayList<Fragment>();
       dupFullOverlap.add(new Fragment("AAGAA"));
       dupFullOverlap.add(new Fragment("AAGAA"));
         
}
  
   @Test
   public void testValidConstructor() {
       Assembler a = new Assembler(one);
   }
  
   @Test
   public void testSimpleAssemble() {
       Assembler a = new Assembler(two);
       assertTrue(a.assembleOnce());
   }
  
   @Test
   public void testSimpleAssembleStop() {
       Assembler a = new Assembler(two);
       assertTrue(a.assembleOnce());
       assertFalse(a.assembleOnce());
   }

   @Test
   public void testCorrectSimpleAssemble() {
       Assembler a = new Assembler(two);
       assertTrue(a.assembleOnce());
       assertFalse(a.assembleOnce());
       assertEquals(Arrays.asList(new Fragment("GCATG")), a.getFragments());
   }
  
   @Test
   public void testNoAssemble() {
       one.add(new Fragment("CAGT"));
       Assembler a = new Assembler(one);
       assertFalse(a.assembleOnce());
       assertEquals(2, a.getFragments().size());
   }
  
   @Test
   public void testDuplicateFullOverlapAssemble() {
       Assembler a = new Assembler(dupFullOverlap);
       assertTrue(a.assembleOnce());
       assertFalse(a.assembleOnce());
       assertEquals(Arrays.asList(new Fragment("AAGAA")), a.getFragments());
   }
  
   @Test
   public void testCorrectThreeAssembleStepwise() {
       Assembler a = new Assembler(three);
       assertEquals(3, a.getFragments().size());
       assertTrue(a.assembleOnce());
       assertEquals(2, a.getFragments().size());
       assertTrue(a.assembleOnce());
       assertEquals(1, a.getFragments().size());
       assertFalse(a.assembleOnce());
       assertEquals(1, a.getFragments().size());
       assertEquals(Arrays.asList(new Fragment("ACACACTGTGGG")), a.getFragments());
   }

   @Test
   public void testCorrectThreeAssembleAll() {
       Assembler a = new Assembler(three);
       a.assembleAll();
       assertEquals(Arrays.asList(new Fragment("ACACACTGTGGG")), a.getFragments());
   }

   @Test
   public void testConstructorArgumentUnharmed() {
       List<Fragment> copy = new ArrayList<Fragment>(three);
       Assembler a = new Assembler(three);
       a.assembleOnce();
       assertEquals(copy, three);
   }
  
   @Test
   public void testTiebreaker() {
       List<Fragment> l =
               new ArrayList<Fragment>(Arrays.asList(
                   new Fragment("GGGAAAC"),
                   new Fragment("AAACGGG"),
                   new Fragment("CCCGTTTA"),
                   new Fragment("TTTAGCCC")));
       Assembler a = new Assembler(l);
       a.assembleOnce();
       assertTrue(a.getFragments().contains(new Fragment("GGGAAACGGG")));
   }
  
   @Test
   public void testSequenceHaemoglobinSubunitBeta() {
       Assembler a = new Assembler(Arrays.asList(
               new Fragment(
                       "CAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCA"),
               new Fragment(
                       "TCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTT"),
               new Fragment(
                       "TTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC"),
               new Fragment(
                       "ACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGA"),
               new Fragment(
                       "GCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCA"),
               new Fragment(
                       "ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCT")));
       a.assembleAll();
       assertEquals(1, a.getFragments().size());
       assertEquals(new Fragment("ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGC"),
               a.getFragments().get(0));
   }

}

0 0
Add a comment Improve this question Transcribed image text
Answer #1

Assembler.java


package sequencer;

import java.util.List;
import java.util.ArrayList;

public class Assembler {
   public List<Fragment> Fragments = new ArrayList<Fragment>();
   /**
   * Creates a new Assembler containing a list of fragments.
   *
   * The list is copied into this assembler so that the original list
   * will not be modified by the actions of this assembler.
   *
   * @param fragments
   */
   public Assembler(List<Fragment> fragments) {
       for(int i = 0; i < fragments.size(); i++){
           Fragments.add(fragments.get(i));
       }
   }
  
   /**
   * Returns the current list of fragments this assembler contains.
   * @return the current list of fragments
   */
   public List<Fragment> getFragments() {
       return Fragments;
   }
  
   /**
   * Attempts to perform a single assembly, returning true if an assembly was performed.
   *
   * This method chooses the best assembly possible, that is,
   * it merges the two fragments with the largest overlap, breaking ties
   * between merged fragments by choosing the shorter merged fragment.
   *
   * Merges must have an overlap of at least 1.
   *
   * After merging two fragments into a new fragment, the new fragment is inserted into
   * the list of fragments in this assembler, and the two original fragments are removed
   * from the list.
   *
   * @return true iff an assembly was performed
   */
   public boolean assembleOnce() {  
       int overlapForMerge = 0;
       int biggestOverlap = -1;
      
       Fragment fragmentFront = null;
       Fragment fragmentEnd = null;
       Fragment merged = null;
      
       for(int i = 0; i < Fragments.size(); i ++){
               for(int j = 0; j < Fragments.size(); j ++){
                   if(Fragments.get(i) == null || Fragments.get(j) == null){
                       return false;
                   }
                   if(Fragments.get(i) != Fragments.get(j)){
                       overlapForMerge = Fragments.get(i).calculateOverlap(Fragments.get(j));
                       if(overlapForMerge > biggestOverlap){
                           biggestOverlap = overlapForMerge;
                           fragmentFront = Fragments.get(i);
                           fragmentEnd = Fragments.get(j);
                       }
                   }
               }
       }
      
       if(biggestOverlap > 0){
           Fragments.remove(fragmentFront);
           Fragments.remove(fragmentEnd);
           merged = fragmentFront.mergedWith(fragmentEnd);
           Fragments.add(merged);
           return true;
       }
       else {
           return false;
       }
   }
  
   /**
   * Repeatedly assembles fragments until no more assembly can occur.
   */
   public void assembleAll() {
       while(assembleOnce() != false){
           assembleOnce();
       }
   }
}

Add a comment
Know the answer?
Add Answer to:
Need some assistance coding this assembler exercise. I have included the test file. Thank you very...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Please help complete the items marked TODO in the code and get the tests to pass:...

    Please help complete the items marked TODO in the code and get the tests to pass: import static org.junit.Assert.assertEquals; import static org.junit.Assert.assertFalse; import static org.junit.Assert.assertTrue; import static org.junit.Assert.fail; import java.util.ArrayList; import java.util.Iterator; import java.util.List; import org.junit.After; import org.junit.Before; import org.junit.Test; public class TestIterator { private List<Integer> list; // See the Java List Interface documentation to understand what all the List methods do ... @Before public void setUp() throws Exception { list = new ArrayList<Integer>(); // TODO also try with a...

  • I need some help fixing this error. I completed the code, just modify it so the...

    I need some help fixing this error. I completed the code, just modify it so the error is gone. I had to remove the imports and parts of the test to fit everything public class Scheduler {    private List listOfCourses;    private List listOfStudents;    public Scheduler() {    listOfCourses = new ArrayList();    listOfStudents = new ArrayList();    }    public void addCourse(Course course) {    listOfCourses.add(course);    }    public List getCourses() {    List courseList =...

  • I am not passing some of the code when i run the testing . PriorityQueue public...

    I am not passing some of the code when i run the testing . PriorityQueue public class PriorityQueue<T extends Comparable<T>> implements IPriorityQueue<T> {    private Vector<T> theVector = new Vector<>(0, 1);    private int size = 0;    @Override    public void insert(T element) {        theVector.pushBack(element);        size++;        bubbleUp(); }    @Override    public T peekTop() throws java.util.NoSuchElementException {        if (isEmpty()) {            throw new java.util.NoSuchElementException();        }       ...

  • Need help with a number guessing game in java 1) You should store prior guessses in...

    Need help with a number guessing game in java 1) You should store prior guessses in a linked list, and the nodes in the list must follow the order of prior guesses. For example, if the prior guesses are 1000, 2111, 3222 in that order, the nodes must follow the same order 2) You should store the candidate numbers also in a linked list, and the nodes must follow the order of numbers (i.e. from the smallest to the largest)....

  • I need help with todo line please public class LinkedList { private Node head; public LinkedList()...

    I need help with todo line please public class LinkedList { private Node head; public LinkedList() { head = null; } public boolean isEmpty() { return head == null; } public int size() { int count = 0; Node current = head; while (current != null) { count++; current = current.getNext(); } return count; } public void add(int data) { Node newNode = new Node(data); newNode.setNext(head); head = newNode; } public void append(int data) { Node newNode = new Node(data);...

  • how would i use test.add because i would like to use add import java.io.File; import java.io.FileNotFoundException;...

    how would i use test.add because i would like to use add import java.io.File; import java.io.FileNotFoundException; import java.util.ArrayList; import java.util.Arrays; import java.util.List; import java.util.Scanner; public class checkFruit { private List<String> tests; public List<String> getFruit(String fruits) { tests = new ArrayList<String>(Arrays.asList(fruits.split(","))); for (String test : tests) { System.out.println(test); tests.add()//how would i use add here } return tests; } public static void main(String[] args) { Scanner in = new Scanner(System.in); System.out.print("Enter file name: "); File file = new File(in.nextLine()); try { checkFruit...

  • Please help complete the items marked TODO in the code and get the tests to pass:...

    Please help complete the items marked TODO in the code and get the tests to pass: import java.util.ArrayList; import java.util.LinkedList; import java.util.List; import org.junit.After; import org.junit.Before; import org.junit.Test; public class TestPerformance { // TODO run test and record running times for SIZE = 10, 100, 1000, 10000, ... // (choose in conjunction with REPS below up to an upper limit where the clock // running time is in the tens of seconds) // TODO (optional) refactor to DRY // TODO...

  • Please help complete the items marked TODO in the code and get the tests to pass:...

    Please help complete the items marked TODO in the code and get the tests to pass: Someone already answered it, but it was incorrect! import java.util.ArrayList; import java.util.LinkedList; import java.util.List; import org.junit.After; import org.junit.Before; import org.junit.Test; public class TestPerformance { // TODO run test and record running times for SIZE = 10, 100, 1000, 10000, ... // (choose in conjunction with REPS below up to an upper limit where the clock // running time is in the tens of seconds)...

  • package com.spartasystems.interview; public class FloorPlan { private final int width; private final int length; public FloorPlan(int...

    package com.spartasystems.interview; public class FloorPlan { private final int width; private final int length; public FloorPlan(int length, int width){ this.width = width; this.length = length; } } package com.spartasystems.interview; import java.util.ArrayList; import java.util.List; import java.util.Map; public class FloorPlanUtility { /** * Given a map of building names and floor plans and a number 'n', * return a list of 'n' building names that were mapped to the * FloorPlans with the largest areas * * Things to consider: * *...

  • I have currently a functional Java progam with a gui. Its a simple table of contacts...

    I have currently a functional Java progam with a gui. Its a simple table of contacts with 3 buttons: add, remove, and edit. Right now the buttons are in the program but they do not work yet. I need the buttons to actually be able to add, remove, or edit things on the table. Thanks so much. Here is the working code so far: //PersonTableModel.java import java.util.List; import javax.swing.table.AbstractTableModel; public class PersonTableModel extends AbstractTableModel {     private static final int...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT