Question





The cleavage pattern for o-lodosobenzoate is C-terminal to tryptophan; the cleavage pattern for thrombin is C-terminal to arg
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Ans ) The correct option is first one

Trp-Gly-Arg-Gly-pro-Arg-Val-Trp-Ser-Thr-Arg-Leu

Add a comment
Know the answer?
Add Answer to:
The cleavage pattern for o-lodosobenzoate is C-terminal to tryptophan; the cleavage pattern for thrombin is C-terminal...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A...

    please explain how to solve this problem, the answer is provided 9. Peptides: (20 pts.). A polypeptide (X) gives 7 fragments when treated with chymotrypsin (A-G). The same peptide also gives 9 fragments when treated with trypsin (I- IX). After Chymotrypsin A) Thr-Thr-Tyr-Ala-Gly-Phe-Phe-Ile-Asp- Lys B) Ala-Cys-Pro-Leu-Tyr-Gin-lle-Arg C) Met-Ser-Thr-Tyr-Pro-Gly-Arg D) Cys-Leu-Val-Phe-Ile-Lys E) Leu-Ala-Trp-Gly-Val F) Ser-Phe-Ala-Pro-Lys G) Met-Asp-Lys Afier Trypsin I) Ala-Pro-Lys-Met-Asp-Lys-Thr-Thr-Tyr II) Pro-Gly-Arg-Cys-Leu-Val-Phe III) Ile-Lys-Ala-Cys-Pro-Leu-Tyr IV) Ile-Asp-Lys-Met-Ser-Thr-Tyr V) Gin-Ile-Arg-Leu-Ala-Trp VIAla-Gly-Phe VII) Gly-Val VIII) Ser-Phe LX) Phe A) What is the primary...

  • What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on y...

    What two restriction enzymes could you use if you wanted to produce a protein that was fused to a GST-tag that could be removed using thrombin? Would this experimental design place any other tags on your protein? Here is the vector: T7 promoter lac operator Xbal rbs Ndel AATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCCCCT Met Ser Pro GST Ta His TagSacl ATACTAGGTTAT.627bp...GACCATCCTCCAAAATCGGATGGTTCAACTAGTGGTTCTGGTCATCACCATCACCATCACTCCGCGGGTCTGGTGCCACGCGGTAGT lle Leu Gly Tyr.. .209aa. . . Asp His Pro Pro Lys Ser Asp Gly Ser Thr Ser Gly Ser Gly His His...

  • What fragments will be obtained by a trypsin hydrolysis of the following octapeptide? Ala-Val-Trp-Lys-Phe-Gly-Arg-Met A) Ala-Val-Trp-Lys-Phe...

    What fragments will be obtained by a trypsin hydrolysis of the following octapeptide? Ala-Val-Trp-Lys-Phe-Gly-Arg-Met A) Ala-Val-Trp-Lys-Phe and Gly-Arg-Met 3) Ala-Val-Trp-Lys-Phe-Gly and Arg-Met - Ala-Val-Trp-Lys and Phe-Gly-Arg and Met ) Ala-Val-Trp-Lys and Phe and Gly-Arg and Met ) Ala-Val-Trp and Lys-Phe-Gly and Arg-Met Bradykinin is a nonapeptide, Arg-Pro-Pro-Gly-Phe-Ser-Pro-Phe-Arg. In addition to one mole of Arg, what peptides are present after hydrolysis of bradykinin with chymotrypsin? A) Arg-Pro-Pro and Gly-Phe and Ser-Pro-Phe B) Pro-Pro-Gly and Phe-Ser-Pro-Phe-Arg C) Arg-Pro-Pro-Gly-Phe and Ser-Pro-Phe ?) Arg-Pro-Pro-Gly-Phe-Ser...

  • repulsion within the protein 10. Which of the following amino acids do not contain a chiral...

    repulsion within the protein 10. Which of the following amino acids do not contain a chiral carbon? a. Proline b. Alanine c. Glycine d. Phenylalanine e. Tyrosine 11. You want to determine an amino acid sequence for a particular polypeptide. So you degrade the peptid and get the following fragments. Determine the peptide sequence. Digested with typsin: Met-Val-Ser-Thr-Lys Val-lle-Trp-Thr-Leu-Met-lle Leu-Phe-Asn-Glu-Ser-Arg Digested with chymotrypsin: Asn-Glu-Ser-Arg-Val-lle-Trp Thr-Leu-Met-lle Met-Val-Ser-Thr-Lys-Leu-Phe a. Val-lle-Trp-Thr-Leu-Met-lle-Leu-Phe-Asn-Glu-Ser-Arg-Met-Val-Ser-Thr-Lys b. Val-lle-Trp-Thr-Leu-Met-lle-Met-Val-Ser-Thr-Lys-Leu-Phe-Asn-Glu-Ser-Arg c. Leu-Phe-Asn-Glu-Ser-Arg-Met-Val-Ser-Thr-Lys-Val-lle-Trp-Thr-Leu-Met-le d. Met-Val-Ser-Thr-Lys-Leu-Phe-Asn-Glu-Ser-Arg-Val-le-Trp-Thr-Leu-Met-lle e. Met-Val-Ser-Thr-Lys-Val-lle-Trp-Thr-Leu-Met-lle-Leu-Phe-Asn-Glu-Ser-Arg

  • 5. Consider the following peptide: His-Ser-Gln-Gly-Thr-Phe-Thr-Ser-Asp-Tyr-Ser-Lys-Tyr-Leu-Asp-Ser-Arg-Arg-Ala-Gin- Asp-Phe-Val-Gln-Trp-Leu-Met-Asn-Thr a. What are the fragments, if it is cleaved...

    5. Consider the following peptide: His-Ser-Gln-Gly-Thr-Phe-Thr-Ser-Asp-Tyr-Ser-Lys-Tyr-Leu-Asp-Ser-Arg-Arg-Ala-Gin- Asp-Phe-Val-Gln-Trp-Leu-Met-Asn-Thr a. What are the fragments, if it is cleaved by trypsin? b. What are the fragments, if it is cleaved by chymotrypsin? c. What are the fragments, if it is cleaved by pepsin?

  • a) Line up the fragments below so that fragments with the same sequences overlap. Drag each...

    a) Line up the fragments below so that fragments with the same sequences overlap. Drag each fragment to the appropriate location. Gly-Val-Tyr Gly-Val-Tyr-Arg Arg-Asn-Tyr Asn-Tyr-Ala-Val-Thr-Cys-Asn-Gln-Lys Ala-Val-Thr-Cys-Asn-Gln-Lys-Trp Trp-Ser Ser continued below... b) Write the sequence of the peptide. Ala-Arg-Asn-Asp-Cys-Gln-Gly-Lys-Pro-Ser-Thr-Trp-Tys

  • Explain this question please! Name (4 ofer to the Table of Amino Acids at the beginning of the exam to help solve this problem. Polypeptide I is a 12-mer and has the following amino acid compositi...

    Explain this question please! Name (4 ofer to the Table of Amino Acids at the beginning of the exam to help solve this problem. Polypeptide I is a 12-mer and has the following amino acid composition: Ala, Arg, 2 His, Leu, 2 Lys, 2 Phe, Ser, Thr, Trp Edman degradation of I shows that its N-terminal amino acid is His. Chymotrypsin cleavage of I yields peptide fragments A-D.Trypsin cleavage of I gives peptide fragments E-G. Shown below is the amino...

  • Question Completion Status: O Tryptophan and tyrosine QUESTION 2 2 points Save Answer Which of the...

    Question Completion Status: O Tryptophan and tyrosine QUESTION 2 2 points Save Answer Which of the following stretches of amino acid residues would you expect to find in the interior of protein molecules? O Gly-Tyr-His-Arg-His O Ala-Val-Leu-lle-Trp O Ala-Asp-Asp-Tyr-Arg O Gly-Lys-Ser-Pro-Thr OPhe-Glu-Gin-Glu-Asn QUESTION 3 2 points Save Answer The observation that proteins often renature into their original conformations after

  • How to do this problem? 1.A 14 AA peptide contains: Ala, Arg,, Gly, His, Leu, Lys, Phez, Serz, Trp, Tyr, Val This pe...

    How to do this problem? 1.A 14 AA peptide contains: Ala, Arg,, Gly, His, Leu, Lys, Phez, Serz, Trp, Tyr, Val This peptide yields the following results when broken down into smaller fragments Please note the AA are given in alphabetical order). Show your work, explain your reasoning, give the answer in three letter abbreviation and one letter abbreviation Fragment Content His Treatment Edman Chymotrypsin Gly. His, Phe Ser, Tyr Arg2, Leu, Lys, Ser.Ala, Phe Trp, Val Gly, His, Lys,...

  • Need help with #2 Clearly provide the 3-letter symbol for the correct sequence of cach amino...

    Need help with #2 Clearly provide the 3-letter symbol for the correct sequence of cach amino acid in each of listings of the amino acids in the peptide or in any fragments are simply listed in alphabetical order. A subscriptive the number of that amino acid. Use parentheses to incorporate the unknown amino acids after each treatment 1. A five amino acid peptide contains: Arg. Glu, His, Phe, and Ser This peptide yields the following results when broken down into...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT