Question

should be done in python please help9) A file named floats.txt contains a bunch of numbers. Create a file named stats.txt that contains: the minimum number, the

0 0
Add a comment Improve this question Transcribed image text
Answer #1

#The Question can be answered in two ways.

#1)Using general calculation

#2)Using numpy module

#First Approach

from math import sqrt
#opening floats.txt in read mode
fp=open("floats.txt","r")
floats=[]
for line in fp.readlines():
   #Converting each line in txt file to float
   floats.append(float(line))
#Closing fp
fp.close()
minimum=min(floats)
maximum=max(floats)
total=sum(floats)
average=total/len(floats)
"""
The forumla for standard deviation is

sqrt(sum((x_i - average(x))**2)/n)
"""
difference=0
for x in floats:
   difference+=abs(x-average)**2
std=sqrt(difference/len(floats))
#Opening stats.txt in write mode
fp=open("stats.txt","w")
fp.write(str(minimum)+"\n")
fp.write(str(maximum)+"\n")
fp.write(str(total)+"\n")
fp.write(str(average)+"\n")
fp.write(str(std)+"\n")
#Closing "stats.txt"
fp.close()

CUsersK.S.K\Desktop\Coding\Chegg\Python\statistics. py - Sublime Text (UNREGI.. CAUsersK.S.KDesktopl Coding\Chegg\ Python\st.

#Second Approach

import numpy as np
from math import sqrt
#opening floats.txt in read mode
fp=open("floats.txt","r")
floats=[]
for line in fp.readlines():
   #Converting each line in txt file to float
   floats.append(float(line))
#Closing fp
fp.close()

floats=np.array(floats)

minimum=floats.min()
print(minimum)
maximum=floats.max()
print(maximum)
total=floats.sum()
print(total)
average=floats.mean()
print(average)
std=floats.std()
print(std)

#Opening stats.txt in write mode
fp=open("stats.txt","w")
fp.write(str(minimum)+"\n")
fp.write(str(maximum)+"\n")
fp.write(str(total)+"\n")
fp.write(str(average)+"\n")
fp.write(str(std)+"\n")
#Closing "stats.txt"
fp.close()

jupyter Untitled Last Checkpoint: 03/20/2019 (autosaved) Logout Python 3 Help Trusted File Edit View Insert Cell Kemel Widget

Add a comment
Know the answer?
Add Answer to:
should be done in python please help 9) A file named floats.txt contains a bunch of...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Create a python code named LetterCount with a text file named words.txt that contains at least...

    Create a python code named LetterCount with a text file named words.txt that contains at least 100 words in any format - some words on the same line, some alone (this program involves no writing so you should not be erasing this file). Then create a program in the main.py that prompts the user for a file name then iterates through all the letters in words.txt, counting the frequency of each letter, and then printing those numbers at the end...

  • *PYTHON EXPERTS ONLY PLEASE* Please provide the answer coded in Python using comments to explain code...

    *PYTHON EXPERTS ONLY PLEASE* Please provide the answer coded in Python using comments to explain code function. Good answers will be rated with thumbs up! Please answer both parts. Thank you for your time. Question 3 - Suppose you have a file named numbers.csv which contains a bunch of integers, five per line of text, separated by commas. Write code below that will open the _le, read the numbers from it, and print the sum of all the even numbers...

  • Could anyone please help with this Python code assignment? In this programming assignment you are to...

    Could anyone please help with this Python code assignment? In this programming assignment you are to create a program called numstat.py that reads a series of integer numbers from a file and determines and displays the following: The name of the file. The sum of the numbers. The count of how many numbers are in the file. The average of the numbers. The average is the sum of the numbers divided by how many there are. The maximum value. The...

  • USING PYTHON PROGRAMMING LANGUAGE 15. Write code to open a file named data.txt, which contains 3...

    USING PYTHON PROGRAMMING LANGUAGE 15. Write code to open a file named data.txt, which contains 3 numbers, and print the sum of those numbers to the console 16. Write code that opens a file named words.txt containing an essay, and the prints out the SECOND word in the file to the console

  • In python Attached is a file called sequences.txt, it contains 3 sequences (one sequence per line)....

    In python Attached is a file called sequences.txt, it contains 3 sequences (one sequence per line). Also attached is a file called AccessionNumbers.txt. Write a program that reads in those files and produces 3 separate FATSA files. Each accession number in the AccessionNumbers.txt file corresponds to a sequence in the sequences.txt file. Remember a FASTA formatted sequence looks like this: >ABCD1234 ATGCTTTACGTCTACTGTCGTATGCTTTACGTCTACTGACTGTCGTATGCTTACGTCTACTGTCG The file name should match the accession numbers, so for 1st one it should be called ABCD1234.txt. Note:...

  • In python Attached is a file called sequences.txt, it contains 3 sequences (one sequence per line)....

    In python Attached is a file called sequences.txt, it contains 3 sequences (one sequence per line). Also attached is a file called AccessionNumbers.txt. Write a program that reads in those files and produces 3 separate FATSA files. Each accession number in the AccessionNumbers.txt file corresponds to a sequence in the sequences.txt file. Remember a FASTA formatted sequence looks like this: >ABCD1234 ATGCTTTACGTCTACTGTCGTATGCTTTACGTCTACTGACTGTCGTATGCTTACGTCTACTGTCG The file name should match the accession numbers, so for 1st one it should be called ABCD1234.txt. Note:...

  • (Python 3) Write a program that reads the contents of a text file. The program should...

    (Python 3) Write a program that reads the contents of a text file. The program should then create a dictionary in which the keys are individual words found in the file and the values are the number of times each word appears and a list that contains the line numbers in the file where the word (the key) is found. Then the program will create another text file. The file should contain an alphabetical listing of the words that are...

  • Should be done in Python, please help Create a class for a 2x2 matrix. Give the...

    Should be done in Python, please help Create a class for a 2x2 matrix. Give the init function and create functions to return each entry of the 2x2 matrix.

  • PYTHON write a program that will open a file named data.txt and read each line of...

    PYTHON write a program that will open a file named data.txt and read each line of the file one at a time. Each line should be printed to the screen along with a line number

  • 1.Write a python program that writes a series of random numbers to a file named random.txt....

    1.Write a python program that writes a series of random numbers to a file named random.txt. Each random number should be in the range of 1 through 300. The application should let the user specify how many random numbers the file will hold. 2. Write another program that reads the random numbers from the random.txt file, displays the numbers, then displays the following data: I. The total of the numbers II. The number of random numbers read from the file

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT