Question

3-25. The function of DNA is to while the function of RNA is to A) store information about proteins: construct proteins based
3-22. Which of the following structures illustrates an amino acid at physiological pH! D) B 3-23. What type of interaction wo
0 0
Add a comment Improve this question Transcribed image text
Answer #1

3-22. Physiological pH is 7 where N terminus stays protonated and c terminus deprotonated. b is correct.

3-23. COO- and NH3+can undergo hydrogen bonding interaction.A.

3-24. 3 nucleotide involved, t-RNA and code amino acids. E is option.

3-25. A. Information is stored in DNA and RNA construct protein using the information. DNA does not construct or store protein.RNA does not break or transport protein.

3-26. Circle is polar which is part B and C. E is answer.

3-27. Carbon II, III, IV and V are chiral as four different substituents are attached.A is answer.

Add a comment
Know the answer?
Add Answer to:
3-25. The function of DNA is to while the function of RNA is to A) store...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • Why are nucleotides a good molecule to make DNA out of, while amino acids are good...

    Why are nucleotides a good molecule to make DNA out of, while amino acids are good for making proteins? A good answer will include: -how nucleotides compare to amino acids in terms of diversity of shape and feel -how the structure and funciton of DNA compares to the structure and function of proteins -what is the 'job' of DNA? why are the nucleotides good for allowing DNA to carry out its functions? what is the job of a protein? how...

  • 1. Proteins consist of: genes. chains of amino acids. RNA plus mRNA. chains of DNA nucleotides....

    1. Proteins consist of: genes. chains of amino acids. RNA plus mRNA. chains of DNA nucleotides. 2. The structure of DNA is a triple helix double helix hoogesteen comlex 3. There are ______ amino acids that humans use. 15 10 20 25 4. RNA differs from DNA in that it uses: Group of answer choices uracil instead of thymine. uracil instead of guanine. guanine instead of uracil. uracil instead of adenine.

  • Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand...

    Table 1B: Protein Synthesis with 2nd DNA Template Strand DNA Codons in the 2nd Template Strand mRNA Sequence (List codons) Amino Acids in the Protein **Use the Genetic Code Chart on page 217 to determine the amino acids that will be placed in the protein Questions: 19. The three letter "code words of DNA and RNA that specify amino acids are called: A. codons B. promoters C. Introns D. anticodons 20. Proteins are composed of building blocks called: A. fatty...

  • Match what is composed of what 1) RNA is composed of ____ 2) DNA 3) Proteins...

    Match what is composed of what 1) RNA is composed of ____ 2) DNA 3) Proteins 4) Triacyglycerol 5)Glycogen 6)Fats 7)Protein 8)Starch a) lipids b) ribonucleotides c) amino acids d) deoxyribonucleotides e) glucose f) nucleotides g) glucose monomers h) protein

  • Which of the following is NOT a dehydration synthesis reaction? a. amino acids forming proteins b....

    Which of the following is NOT a dehydration synthesis reaction? a. amino acids forming proteins b. glycogen forming glucose molecules c. nucleotides forming DNA d. glucose units forming starch e .fatty acids and glycerol forming a fat 2) The monomer of a protein is a(n) monosaccharide. nucleotide. peptide. glycerol and three fatty acids. amino acid. 3) A starch molecule is to glucose as a protein is to a polypeptide. DNA is to an amino acid. a lipid is to nucleic...

  • c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose...

    c) The steps or rungs of the DNA ladder are composed of phosphate group 4 Deoxyribose 15. Use Figure 2 and 3 of the lab to compare the genome of a human with a mouse, fruit fly and yeast. paired in a specific way. d) Adenine in one DNA strand always pain with thymine ) Bases in opposite strands of a DNA molecule are linked together by hydrogen in the other strand and bonds. Yeast Human Mouse Fruit Fly Number...

  • 1. this proteins is responsible for increasing or decreasing supercoiling of DNA A. Helicase B. DNA...

    1. this proteins is responsible for increasing or decreasing supercoiling of DNA A. Helicase B. DNA Polymerase C. Topoisomerase D. RNA Polymerase E. DNA ligase 2. a gene is best defined as A. A segment of DNA that contains inherited information that defines the structure of a protein or RNA B. thee nucleotides that code for an amino acid C. a translated unit of DNA D. a sequence of nucleotides in RNA that codes for a functional product 3. This...

  • Please give me a complete solutions, don't work on it if you're not going to finished...

    Please give me a complete solutions, don't work on it if you're not going to finished this. This is an old homework, in which I am using to study for the exam. So please don't give me half ass answers. QUESTION 11 If a DNA segment has the sequence GCTAA, what RNA sequence will be made from it? a. CGATT b. CGUTT c. CGAUU d. GCTAA e. UGATT 1 points    QUESTION 12 Which of the following brings amino acids...

  • want to double check! 25. Th e DNA sequences encoding the initiation whese parated bcoding the...

    want to double check! 25. Th e DNA sequences encoding the initiation whese parated bcoding the initiation and termination codons of a certain protein amino acids in length. there of the protei nucleotides on a certain organism's chromosome; however ssuming that there has been no post-translational processing elined from this gene is translated, the protein product is only 250 A. The RNA was synthesized in a bacterial cell n, what can you conclude from these observations? The RNA was synthesized...

  • 3. Below is the template DNA sequence for a short human protein: Template DNA = 3’...

    3. Below is the template DNA sequence for a short human protein: Template DNA = 3’ GCATGACTATTAATACGTGCGCTACCAGACTTGA5’ A. How many amino acids will the protein translated from this mRNA have? B. How many nucleotides in total will be transcribed but not translated? Assume that the stop codon is not part of the untranslated region.

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT