Be sure to answer all parts. Give the amino acid sequence of an octapeptide that contains...
Be sure to answer all parts.
Give the amino acid sequence of an octapeptide that contains the
amino acids Gly, His, Thr, Lys, Arg, Asn (2 equiv) ,Ile, and forms
the following fragments when partially hydrolyzed with HCl:
His―Ile―Thr―Arg, Lys―Asn―His―Ile, and Gly―Asn―Lys.
Homework Answers
The given amino acid sequence on complete hydrolysis gives
Gly, His, Thr, Lys, Arg, Asn(2 equiv), Ile.
and partial hydrolysis gives
His-Ile- Thr-Arg , Lys-Asn-His-Ile, Gly-Asn-Lys.
Now the structure have to placed as two amino acid overlaps
As Asn is present in 2equiv then two fragment combined as
Theses combined to form.
this combined with other
fragment to form the amino acid sequence
Add Answer to:
Be sure to answer all parts.
Give the amino acid sequence of an octapeptide that contains...
Be sure to answer all parts. Give the amino acid sequence of an octapeptide that contains...
Be sure to answer all parts. Give the amino acid sequence of an octapeptide that contains the amino acids Ile, Asp, Thr, Gln, Met, Leu, Lys (2 equiv), and forms the following fragments when partially hydrolyzed with HCl: Asp―Lys―Ile―Thr, Met―Lys―Asp, and Ile―Thr―Gln―Leu.
Be sure to answer all parts. Give the amino acid sequence of an octapeptide that contains the ami...
Be sure to answer all parts. Give the amino acid sequence of an octapeptide that contains the amino acids Leu, Cys, Val, Lys, Gln (2 equiv), His, Tyr, and forms the following fragments when partially hydrolyzed with HCl: Val-Gln-Leu, Leu-Gln-His-Tyr, and His-Tyr-Cys-Lys.
Be sure to answer all parts. Give the amino acid sequence of an octapeptide that contains the amino acids Leu, Cys, Val, Lys, Gln (2 equiv), His, Tyr, and forms the following fragments when partially hydrolyzed with HCl:...
Be sure to answer all parts. Give the amino acid sequence of an octapeptide that contains the ami...
Please help!
Be sure to answer all parts. Give the amino acid sequence of an octapeptide that contains the amino acids Pro, Asp, Gln (2 equiv), Leu, Thr, Cys, Glu, and forms the following fragments when partially hydrolyzed with HCI: Pro-Gln-Cys, Asp-Thr-Leu-Glu, and Cys-Gln-Asp-Thr.
Be sure to answer all parts. Give the amino acid sequence of an octapeptide that contains the amino acids Pro, Asp, Gln (2 equiv), Leu, Thr, Cys, Glu, and forms the following fragments when partially hydrolyzed...
3 attempts left Check my work Be sure to answer all parts. Give the amino acid...
3 attempts left Check my work Be sure to answer all parts. Give the amino acid sequence of an octapeptide that contains the amino acids Ile, Thr, Gin (2 equiv)| Leu, Asp, Glu, Ala, and forms the following fragments when partially hydrolyzed with HCI: Ala-Gin-Asp-Ile, Thr-Gln-Ala, and Asp-Ile-Glu-Leu. - - - - - -
Be sure to answer all parts. An octapeptide contains the following amino acids: Ala, Pro, Gly,...
Be sure to answer all parts. An octapeptide contains the following amino acids: Ala, Pro, Gly, Asp, Trp, Lys, Leu, Met. Carboxypeptidase treatment of the octapeptide forms Asp and a heptapeptide. Treatment of the octapeptide with Chymotrypsin forms forms two tetrapeptides, A and B. Treatment of A with Trypsin yields two dipeptides, C and D. Edman degradation cleaves the following amino acids from each peptide: Gly (octapeptide),Gly (A),Met (B), Gly (C), Leu(D).Partial hydrolysis of tetrapeptide B forms Met-Pro in addition...
Use the given experimental data to deduce the sequence of an octapeptide that contains the amino...
Use the given experimental data to deduce the sequence of an octapeptide that contains the amino acids His, Ala (2 equiv), Val (2 equiv), Ser, Gly, and Pro. Edman degradation cleaves Ala from the octapeptide, and carboxypeptidase forms Gly and a heptapeptide. Partial hydrolysis forms the following fragments: Pro-Val-Gly, His-Val-Pro, Ala, and Ala-Ser-His-Val.
Suppose part of the amino acid sequence of a protein is N... Gly - Ala -...
Suppose part of the amino acid sequence of a protein is N... Gly
- Ala - Pro - Arg - Lys ...C. Which of the following amino acid
sequences could result from a frameshift mutation (+1 or -1) in the
part of the gene that encodes this sequence of amino acids?
Ο N... Gly - Ala - Asn - Ser - Leu ...C Ο Ν...Αla - Ala - Arg - Pro - Lys...C Ο Ν...Gly - Gly - Thr -...
28. What is the amino acid sequence that will be produced from this original DNA sequence:...
28. What is the amino acid sequence that will be produced from this original DNA sequence: 3' GCATGTACACCTTGGCGACGACTGCTTA 5' a. Met - Tyr - Asn - Thr - Leu - Ala - Thr-Thr - Ala b. Met - Trp -Asn-Arg - Cys C. Ala-Lys - Thr-Pro-Gly - Asp - Asp - Cys d. Arg - Thr-Cys - Gly-Pro-Leu-Leu - Thr - Asn e. None of the above Using the original DNA OG the new mutat
This sequence is RNA because:
20. This sequence is RNA because:A) it is single stranded.B) it contains U (uracil) and no T (thymine).C) it runs in a 5' to 3' direction.D) it codes for amino acids.E) it is a small molecule.21. Which amino acids does this sequence code for, if the reading frame is as shown, starting from the correct end? A) gly-ala-arg-cys-ile...B) pro-arg-ala-thr-stopC) met-asn-glu-leu...D) glu-leu-val-val-phe...E) leu-glu-gln-his-asn...22. If the sequence gets changed to 5' ... GGAGACUCGUUGUAUU... 3'. What would be the effect on the amino...
3. (2 Points) Give the one-letter equivalents for all amino acids in the following sequence and...
3. (2 Points) Give the one-letter equivalents for all amino acids in the following sequence and circle the residues most likely to bind to a hard transition-metal ion: Ile-Pro-Arg-Glu-Phe-Glu-Arg-Cys-Ala-Asp-Ile-Ser-Leu-Ile-Lys-Glu-His-Gly
Be sure to answer all parts. Give the amino acid sequence of an octapeptide that contains the amino acids Leu, Cys, Val, Lys, Gln (2 equiv), His, Tyr, and forms the following fragments when partially hydrolyzed with HCl: Val-Gln-Leu, Leu-Gln-His-Tyr, and His-Tyr-Cys-Lys.
Be sure to answer all parts. Give the amino acid sequence of an octapeptide that contains the amino acids Leu, Cys, Val, Lys, Gln (2 equiv), His, Tyr, and forms the following fragments when partially hydrolyzed with HCl:...
Please help!
Be sure to answer all parts. Give the amino acid sequence of an octapeptide that contains the amino acids Pro, Asp, Gln (2 equiv), Leu, Thr, Cys, Glu, and forms the following fragments when partially hydrolyzed with HCI: Pro-Gln-Cys, Asp-Thr-Leu-Glu, and Cys-Gln-Asp-Thr.
Be sure to answer all parts. Give the amino acid sequence of an octapeptide that contains the amino acids Pro, Asp, Gln (2 equiv), Leu, Thr, Cys, Glu, and forms the following fragments when partially hydrolyzed...
3 attempts left Check my work Be sure to answer all parts. Give the amino acid sequence of an octapeptide that contains the amino acids Ile, Thr, Gin (2 equiv)| Leu, Asp, Glu, Ala, and forms the following fragments when partially hydrolyzed with HCI: Ala-Gin-Asp-Ile, Thr-Gln-Ala, and Asp-Ile-Glu-Leu. - - - - - -
Be sure to answer all parts. An octapeptide contains the following amino acids: Ala, Pro, Gly, Asp, Trp, Lys, Leu, Met. Carboxypeptidase treatment of the octapeptide forms Asp and a heptapeptide. Treatment of the octapeptide with Chymotrypsin forms forms two tetrapeptides, A and B. Treatment of A with Trypsin yields two dipeptides, C and D. Edman degradation cleaves the following amino acids from each peptide: Gly (octapeptide),Gly (A),Met (B), Gly (C), Leu(D).Partial hydrolysis of tetrapeptide B forms Met-Pro in addition...
Suppose part of the amino acid sequence of a protein is N... Gly
- Ala - Pro - Arg - Lys ...C. Which of the following amino acid
sequences could result from a frameshift mutation (+1 or -1) in the
part of the gene that encodes this sequence of amino acids?
Ο N... Gly - Ala - Asn - Ser - Leu ...C Ο Ν...Αla - Ala - Arg - Pro - Lys...C Ο Ν...Gly - Gly - Thr -...
28. What is the amino acid sequence that will be produced from this original DNA sequence: 3' GCATGTACACCTTGGCGACGACTGCTTA 5' a. Met - Tyr - Asn - Thr - Leu - Ala - Thr-Thr - Ala b. Met - Trp -Asn-Arg - Cys C. Ala-Lys - Thr-Pro-Gly - Asp - Asp - Cys d. Arg - Thr-Cys - Gly-Pro-Leu-Leu - Thr - Asn e. None of the above Using the original DNA OG the new mutat
3. (2 Points) Give the one-letter equivalents for all amino acids in the following sequence and circle the residues most likely to bind to a hard transition-metal ion: Ile-Pro-Arg-Glu-Phe-Glu-Arg-Cys-Ala-Asp-Ile-Ser-Leu-Ile-Lys-Glu-His-Gly
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago