What kind(s) of chemical bond(s) is(are) involved between a DNA molecule and a histone protein? What kind(s)...
What kind(s) of chemical bond(s) is(are) involved between a DNA molecule and a histone protein? What kind(s) of chemical bond(s) is(are) involve when a substrate molecule interacts with an enzyme?
Homework Answers
The double helix of deoxyribonucleic acid or DNA contains nucleotides. The nucleotides contain a phosphate group. The phosphate group is anionic in nature. Hence, it is negatively charged. Due to the presence of a large number of the phosphate group, DNA molecule gets negatively charged. On the other hand, Histone protein contains positively charged amino acids, lysine, and arginine. Due to the presence of two opposite charges, a strong electrostatic interaction occurs between DNA and Histone protein.
The enzymes contain proteins. The globular proteins present in enzymes contains various amino acids. The main interaction between substrate and active site of the protein is controlled by the interaction between amino acid residue present in protein and substrate. The hydrophobic interaction, weak electrostatic interaction and hydrogen bonding interactions are mainly involved when a substrate molecule interacts with an enzyme.
Add Answer to:
What kind(s) of chemical bond(s) is(are) involved between a DNA
molecule and a histone protein? What kind(s)...
1. What are the structures of chromosomes 2. Identify the components of a histone core and...
1. What are the structures of chromosomes 2. Identify the components of a histone core and describe how a nucleosome is assembled 3. Define the term “histone code”. 4. Identify common histone markers of hetero- and euchromatin. 5. Explain the relationship between methylated DNA and chromatin. 6. Identify types of enzymes involved in chromatin regulation 7. What type of data one can get from chromosome conformation capture (3C). 8. What type of data one can get from ChIP-Seq. 9. What...
COVID 19 and DNA molecule? What kind of virus is COVID - 19? What does that...
COVID 19 and DNA molecule? What kind of virus is COVID - 19? What does that mean in terms of what processes happen inside the cells for it to spread to other cells inside the body? Explain the significance of this observation. The average length of a transcription unit along a eukaryotic DNA molecule is about 8000 nucleotides, whereas an average sized protein is about 400 amino acids long.
What DNA/RNA/protein(s) is/are involved in the following processes in... DNA Replication Transcription - Prokaryotes Transcription -...
What DNA/RNA/protein(s) is/are involved in the following processes in... DNA Replication Transcription - Prokaryotes Transcription - Eukaryotes What serves as the template? Unwinding of DNA Initiation Elongation What direction does elongation occur? Termination What is the end product of this process? How many strands? Processing after?
5. What is the connection between DNA methylation, histone deacetylation, and gene regulation in eukaryotes?
5. What is the connection between DNA methylation, histone deacetylation, and gene regulation in eukaryotes?
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include...
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS
Fully describe and illustrate each level of protein structure. What type(s) of chemical bond/interactions are essential...
Fully describe and illustrate each level of protein structure. What type(s) of chemical bond/interactions are essential at each level? When heat or a strong acid/base is applied, which level of protein structure is least affected?
ATCase is an important enzyme in DNA replication. a) What does this enzyme do and what...
ATCase is an important enzyme in DNA replication. a) What does this enzyme do and what are its substrates? b) This enzyme demonstrates feedback regulation. Describe its quaternary structure in this regard. c) Besides substrate(s) and product, what other molecules are involved in the feedback regulation of ATCase? Describe their function and how they interact?
ATCase is an important enzyme in DNA replication. a) What does this enzyme do and what...
ATCase is an important enzyme in DNA replication. a) What does this enzyme do and what are its substrates? b) This enzyme demonstrates feedback regulation. Describe its quaternary structure in this regard. c) Besides substrate(s) and product, what other molecules are involved in the feedback regulation of ATCase? Describe their function and how they interact?
molecular biology 16. Histone acetyltransferases would be directly involved in which of the following? A. Formation of open chromatin B. Movement of the nucleosome C. Acetylation of lysines D. Termin...
molecular biology
16. Histone acetyltransferases would be directly involved in which of the following? A. Formation of open chromatin B. Movement of the nucleosome C. Acetylation of lysines D. Termination of gene expression E. All of the above are true. 17. What functions are accomplished by the primosome? A. Tracking along DNA B. Tracking along DNA, separating double-stranded DNA C. Tracking along DNA, separating double-stranded DNA, synthesizing RNA primers D. Tracking along DNA, separating double-stranded DNA, synthesizing RNA primers, adding...
What kind of intermolecular forces act between a carbon disulfide molecule and a bromine molecule? What...
What kind of intermolecular forces act between a carbon
disulfide molecule and a bromine molecule?
What kind of intermolecular forces act between a carbon disulfide molecule and a bromine (Br2) molecule? Note: If there is more than one type of intermolecular force that acts, be sure to list them all, with a comma between the name of each forc
What DNA/RNA/protein(s) is/are involved in the following processes in... DNA Replication Transcription - Prokaryotes Transcription - Eukaryotes What serves as the template? Unwinding of DNA Initiation Elongation What direction does elongation occur? Termination What is the end product of this process? How many strands? Processing after?
5. What is the connection between DNA methylation, histone deacetylation, and gene regulation in eukaryotes?
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS
molecular biology
16. Histone acetyltransferases would be directly involved in which of the following? A. Formation of open chromatin B. Movement of the nucleosome C. Acetylation of lysines D. Termination of gene expression E. All of the above are true. 17. What functions are accomplished by the primosome? A. Tracking along DNA B. Tracking along DNA, separating double-stranded DNA C. Tracking along DNA, separating double-stranded DNA, synthesizing RNA primers D. Tracking along DNA, separating double-stranded DNA, synthesizing RNA primers, adding...
What kind of intermolecular forces act between a carbon
disulfide molecule and a bromine molecule?
What kind of intermolecular forces act between a carbon disulfide molecule and a bromine (Br2) molecule? Note: If there is more than one type of intermolecular force that acts, be sure to list them all, with a comma between the name of each forc
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 11 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 11 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 11 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 11 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 11 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 11 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 11 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 11 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 11 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 11 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 11 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 11 months ago