Question

Please Complete the following C Code with Comments explaining your solution and post a screenshot of it working.

Summary: This project explores pattern matching techniques to find a pattern in a DNA sequence containing letters in the DNA alphabet {A, C, G, T}. For example, suppose we have a DNA sequence as follows:

ATGACGATCTACGTATGGCAGCCACGCTTTTGATGTTAAGTCACACAGCCAAGTCA ACAAGGGCGACTTCATGATCTTTCCGCTCCGTTGGTGTAGGCCCGTGTTCAAATTC AATGGCTGATTGGAATTACCTTTGAAATACTCCAACCGACCGCCACGGCCAGGGT CCCGCTCGCTCTCTGTGGCCCTCCCACAAAACTCCGGTGAAAGTTGATTTGGACAC GGACCCAAAGCAGCGTAGATTATTCGAGCGTATTCGGTAGTCATTGAGGCCCCAA

The pattern “AATGG” can be found at the beginning of the third line. Note that overlapping matches are counted individually. For example, if the sequence is ‘AAAAAA’ and the pattern is ‘AAA’, there are 4 occurrences of the pattern. Part 1: A shell program DNA-shell.c is provided that randomly initializes a text string (10240 characters) with the DNA alphabet. A pattern of 3 to 7 characters is also randomly generated using the DNA alphabet. You must insert code into the shell to implement the function 'match' which takes four input parameters, the pointer to the text string, the length of the text string, a pointer to the pattern, and the length of the pattern. The 'match' function must return the array of indices of occurrences of the pattern in the text string. For example, if the sequence is ‘AACAAC’ and the pattern is ‘AAC’, the return value is ‘03’ where ‘0’ indicates the index of the first occurrence of ‘AAC’ and ‘3’ indicates the index of the second occurrence. The shell program includes a print statement for reporting the frequency of occurrences computed by 'match', so it can be properly graded. Its output format should not be modified. You should design, implement, and test your own code. Otherwise you won’t learn the things you need to know for later parts of the projects. Any submitted project containing code not fully created and debugged by the student constitutes academic misconduct. You should use gcc under Ubuntu to develop your program (type man gcc for compiler usage). Normally, you should compile and run your program using the Linux command line: > gcc DNA-shell.c –g –Wall –o DNAsearch > ./DNAsearch In order for your solution to be properly received and graded, there are a few requirements.

1. The file must be named p1-1.c.

2. You name and the date should be included in the header comment.

3. The starting shell program should not be modified except for the replacement of the comment /* your program goes here */ and the addition of declared local variables. It is especially important not to remove or modify the print statement since that will be used in the automatic grading process. 4. Your solution must be properly uploaded to the canvas before the scheduled due date. The canvas p1-1 assignment has details on late penalties and policies.

******************************************************************************************************************************************************************************************

/* Current date   <your name goes here>

This is the only file that should be modified for the C implementation
of Project 1.

This program initializes a DNA sequence of 10,240 random characters and
a pattern of 3 to 7 random characters, all characters are from the DNA
alphabet {A, T, G, C}.

*/

#include <stdio.h>
#include <stdlib.h>
#include <time.h>

#define SEQLEN 10240
#define MAXPATLEN 10
#define NUMCHAR 4

char Alphabet[] = "ACTG";

int main(int argc, char *argv[]) {

char Seq[SEQLEN], Pat[MAXPATLEN];
int I, *MatchLocs, PatLen;
void Print_Seq(char *Seq, int SeqLen);
void Print_Pat(char *Pat, int PatLen);
int *Match(char *Pat, int PatLen, char *Seq, int SeqLen);

srand((unsigned int) time(NULL)); // seed random number generator
PatLen = (rand() % MAXPATLEN) + 1; // compute pattern length  
for (I = 0; I < SEQLEN; I++)
Seq[I] = Alphabet[rand() % NUMCHAR]; // create sequence
for (I = 0; I < PatLen; I++)
Pat[I] = Alphabet[rand() % NUMCHAR]; // create pattern
Print_Pat(Pat, PatLen); // print pattern
Print_Seq(Seq, SEQLEN); // print sequence
MatchLocs = Match(Pat, PatLen, Seq, SEQLEN); // match pattern in sequence
printf("Pattern detected at the following locations:\n");
while (*MatchLocs != -1) printf("Base pair %d in the sequence\n", *MatchLocs++);
return 0;
}

/* Print Sequence

This routine prints the sequence. */

void Print_Seq(char *Seq, int SeqLen) {

int I;

printf("The sequence is ...\n");
for (I = 0; I < SeqLen; I++) {
putchar(Seq[I]);
if (I % 80 == 79)
printf("\n");
}
}

/* Print Pattern

This routine prints the match pattern. */

void Print_Pat(char *Pat, int PatLen) {

int I;

printf("The pattern is ... \"");
for (I = 0; I < PatLen; I++)
putchar(Pat[I]);
printf("\"\n");
}

/* Match

This routine find indices of occurrances of a variable length DNA
patttern in a DNA sequence. A null terminated array of indices of occurences is returned */

int *Match(char *Pat, int PatLen, char *Seq, int SeqLen) {

// insert your code here

return 0; // modify to return the array of indices
}

Answer 1

#include <stdio.h>
#include <stdlib.h>
#include <time.h>

#define SEQLEN 10240
#define MAXPATLEN 10
#define NUMCHAR 4

char Alphabet[] = "ACTG";

int main(int argc, char *argv[]) {

        char Seq[SEQLEN], Pat[MAXPATLEN];
        int I, *MatchLocs, PatLen;
        void Print_Seq(char *Seq, int SeqLen);
        void Print_Pat(char *Pat, int PatLen);
        int *Match(char *Pat, int PatLen, char *Seq, int SeqLen);

        srand((unsigned int) time(NULL)); // seed random number generator
        PatLen = (rand() % MAXPATLEN) + 1; // compute pattern length  
        for (I = 0; I < SEQLEN; I++)
        Seq[I] = Alphabet[rand() % NUMCHAR]; // create sequence
        for (I = 0; I < PatLen; I++)
        Pat[I] = Alphabet[rand() % NUMCHAR]; // create pattern
        Print_Pat(Pat, PatLen); // print pattern
        Print_Seq(Seq, SEQLEN); // print sequence
        MatchLocs = Match(Pat, PatLen, Seq, SEQLEN); // match pattern in sequence
        printf("Pattern detected at the following locations:\n");
        while (*MatchLocs != -1) printf("Base pair %d in the sequence\n", *MatchLocs++);
        return 0;
}

/* Print Sequence

This routine prints the sequence. */

void Print_Seq(char *Seq, int SeqLen) {

        int I;

        printf("The sequence is ...\n");
        for (I = 0; I < SeqLen; I++) {
                putchar(Seq[I]);
                if (I % 80 == 79)
                        printf("\n");
        }
}

/* Print Pattern
This routine prints the match pattern. */
void Print_Pat(char *Pat, int PatLen) {
        int I;

        printf("The pattern is ... \"");
        for (I = 0; I < PatLen; I++)
                putchar(Pat[I]);
        printf("\"\n");
}

/* Match
This routine find indices of occurrances of a variable length DNA
patttern in a DNA sequence. A null terminated array of indices of occurences is returned */

int *Match(char *Pat, int PatLen, char *Seq, int SeqLen) {

        int *result = malloc(sizeof(int) * SeqLen);

        // insert your code here
        int i=0, j=0;
        int count = 0;
        for(i=0; i<(SeqLen - PatLen + 1); i++) {
                int matched = 1;
                for(j=0; j<PatLen; j++) {
                        if(Pat[j] != Seq[i+j]) {
                                matched = 0;
                        }
                }

                if(matched) {
                        result[count++] = i;
                }
        }

        result[count++] = -1;
        return result; // modify to return the array of indices
}

please upvote. Thanks!