Question

Using Perl: Write a subroutine to report the percentage of each nucleotide in DNA. You've
seen the plus operator +. You will also want to use the divide operator / and the
multiply operator *. Count the number of each nucleotide, divide by the total
length of the DNA, then multiply by 100 to get the percentage. Your arguments
should be the DNA and the nucleotide you want to report on. The int function
can be used to discard digits after the decimal point, if needed.

Answer 1

use strict;
use warnings;

my $DNA = 'ACGTACGTCGTACGTCGTAGCTAGCAGCGTAATAGCGCGCCGCGGATATGG';

my $base = 'A';

print "The percentage of $base in the DNA is ", nucleotide_percentage($DNA, $base), "\n";

exit;

sub nucleotide_percentage {
   my($dna, $nucleotide) = @_;

   my $length = length $dna;

   if($length == 0) { # It's illegal to divide by 0 in most computer languages,
           # so we check for it before the divide in the next line.
       return 0;
   }

   # To interpolate the variable $nucleotide in the tr/// function, you have
   # to use an "eval" on the pattern match (consult the documentation)
   # $count = (eval "$dna =~ tr/$nucleotide//");
   # Since that's a bit obscure, we'll use a global pattern match instead

   my $count = 0;
   while($dna =~ /$nucleotide/g) { $count++}

   return ( int ( 100 * ( $count / $length) ) );
}