Question

We understand that your diagram will not be able to portray the bands to their exact base-pair size, and that in some cases y0...0 ori 463 Msc 258 989 GST CD Btql 4885 762...780 SCREEN-F 945 8amHI 955 EcoRI 960 Xma 960 Smal 965 Sall EcoRV 4132 970 XhXmaI EcoRI SmaI BamHI at cct cca aaa tcg gat ctg gaa gtt otg ttc cag ggg ccc ctg gga tcc cca gga att c < 960 1.2 950 910 920Primer Sequences Primer NamePrimer Sequence (5 to 3) RKSG-Fwd RKSG-Rev SCREEN-F SCREEN-R ggccatgaacttcctgcac tacctggccagggcTarget DNA Sequence tggaagctcaggttccgcatcatccatgagaccagcttggccatgaacttcctgcacagc <60 10 20 30 40 50 attaagccgcctctgctccacctgg

We understand that your diagram will not be able to portray the bands to their exact base-pair size, and that in some cases you may not be able to calculate an exact size for your bands. Just do your best in terms of positioning the bands in the lanes with respect to the standard markers, but please do not panic if the bands are a couple of mm away from perfect in your diagram. LABEL each band with its size in bp-we will tolerate a ±10 bp difference betwee our value and he true value. Lane 1 -pGEX6P2 with NO insert, digested with Btg I and Pst I Pst l Lane 2 - pGEX6P2 with the PCR product inserted in the correct orientation (the coding sequence is in the same direction as the GST encoded by pGEX), digested with Btg I and Lane 3-pGEX6P2 with the PCR product inserted in the incorrectorientation (the coding sequence is in the opposite direction compared to the GST encoded by pGEX), digested with Btg I and Pst I polymerase, buffer, water) and ONLY the SCREENR primer (no SCREEN-F primer). template, dNTPs, Taq polymerase, buffer, water) and BOTH the SCREEN-F and SCREEN-R primers. Lane 4: In this lane draw the fragments that would result from a PCR that uses all of the necessary PCR components (including pGEX6P2 with no insert as template, dNTPs, Taq Lane 5: In this lane draw the fragments that would result from a PCR that uses all of the necessary PCR components (including pGEX6P2 with the PCR product inserted as Note: all the sites are marked on the plasmid map.
0...0 ori 463 Msc 258 989 GST CD Btql 4885 762...780 SCREEN-F 945 8amHI 955 EcoRI 960 Xma 960 Smal 965 Sall EcoRV 4132 970 Xhol 1151 1132 SCREEN-R pGEX6P2.xdna - 4985 nt 1393 2253 Amp R 1934 Pst 2108 >Bsal
XmaI EcoRI SmaI BamHI at cct cca aaa tcg gat ctg gaa gtt otg ttc cag ggg ccc ctg gga tcc cca gga att c
0 0
Add a comment Improve this question Transcribed image text
Answer #1

Lane 2 pGEX6P2 with the PCR product inserted in the correct orientation (the coding sequence is in the same direction as the

5 4 3 2 10 kb 8kb 5kb 4kb 5kłi 2.kb 1.5kb 1kb 750 bp 500bp 250bpPlease write to me if you need more help.

Add a comment
Know the answer?
Add Answer to:
We understand that your diagram will not be able to portray the bands to their exact base-pair si...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT