
11.20 Explain the difference in the melting points of the following compounds: NO2 NO OH OH .p. 115°C m.p. 45°C m (Hint...
Question 14 The melting point of a pure compound is known to be 110-111º. Describe the melting behavior expected if this compound is contaminated with 5% of an impurity. 90-96 111-113 90-91 110-111 5 pts Question 15 You and your lab partner take melting points of the same sample. You observe a melting point of 101-107°C, while your partner observes a value of 110-112°C. Explain how you can get two different values with exactly the same sample. One of the...
6). (10 points) Predict the mononitration products of the following compounds. a) o-nitrotoluene b) m-chlorotoluene c) o-bromobenzoic acid d) p-methoxybenzoic acid e) m-cresol (m-methylphenol) (Two products) (Three products) (Two products) (One product) (Three products) 7). (12 points) Show how you would synthesize the following aromatic derivatives from benzene. You don't have to show mechanisms just show synthesis pathways. a) p-tert-butylnitrobenzene b) p-toluenesulfonic acid c) p-chlorotoluene glad noeg banorte
6. Which of the following compounds will have higher boiling point? a)CH CH2CH2OH b)CH,CH2CH2CH.CH c)HOCH CH2OH 7. What is the difference between alkane, alkene and alkyne? 8. Which of the following compound can participate in hydrogen bonding? i. 2-propanol Acetic acid ii. The side chain of serine iv. The side chain of phenylalanine a. i and il b. i only c. Iiland ly d. and iv 9. Rotation around each C-C bond is not possible for which compound? a. Propanol-2...
My answers: Not sure if they are correct.
1. a. London dispersion
b. H-bonding, dipole-dipole, london dispersion
c. London dispersion
d. Ionic, london disperson
2. The second one because not a lot of H+ and less acidic. Need
help understanding the meaning of the question.
3. Diethyl cannot h-bond because it does not provide intermolecular
bonding engery while 1-b. can form h-bond making strong
intermolecular bonds to take up greater engery to break
molecules.
4. Not sure...
11 Explain how IR spectroscopy could be used to following two compounds, by comparing: distinguish between the The C-O Stretch The C-O Bend The Aromatic Region C-H Stretch The two molecules will produce an identical IR spectrum al b) c) d) e) 12 What must take place in order for infrared absorption to occur? a) Electrons must be promoted from their ground state orbital to a higher energy orbital. b) Bending of covalent bonds causing the nuclei of the atoms...
A. Consider the following pairs of structures. Designate each
chirality center as (R) or (S) and identify the
relationship between them by describing them as representing
enantiomers, diastereomers, constitutional isomers, or two
molecules of the same compound. Use handheld molecular models to
check your answers.
B. Tartaric acid
[HO2CCH(OH)CH(OH)CO2H] was an important
compound in the history of stereochemistry. Two naturally occurring
forms of tartaric acid are optically inactive. One optically
inactive form has a melting point of 210 − 212 °...
Question 55 Not yet answered Points out of 2.50 P Flag question Consider the following DNA fragment. Which of the two strands could be used as a template for transcription? Once translated, how many aminoacids would be produced? 5' - ATTGGCCGATATAAACGTACTAATGCCCAGCCGAATTGTAATCCATTGACCC -31 3'- TAACCGGCTATATTTGCATGATTACGGGTCGGCTTAACATTAGGTAACTGGG -5' Select one: a. The template is the bottom strand. The peptide formed will have 8 amino acids о b. The template is the top strand. The peptide form will have 9 amino acids O c....
L. Explain why a solution of 0.10 M HNO(ag) conducts more electrical current than does a solution of 0.10 M formic acid, HCOOH. 2. Explain the observed trend in melting points in the hydrogen halides. HI HBr 88.5 °C HF 83.1 "C 14.8° Ethanol has a heat of vaporization of 38.56 kJ/msol and a normal boiling point of 78.4°C. what is the vapor 3. pressure ofethanol at 15 ℃ ? 4. One type of household bleach contains 455% sodium hypochlorite(NaOCl)...
PLEASE HELP WITH THESE. THANK
YOU
How are the following two compounds related? CH CH3 HO -H HO -Н Given the following substitution reaction, what would the effect be of changing the solvent from CH3OH to (CH3)2S=0? H- OH H OH VS HO -H H -OH H -OH HO H + CH (CH2CH2-Br NaOH CH;(CH2), CH2-OH + NaBr CH OH CH2OH A. The reaction rate will increase. OB. There is no effect on the rate of the reaction, C. The...
1) Name the following carboxylic acids (use both IUPAC and common names): ОН ОН (b) (c) ОН ОН (d) Br ОН ОН NH2 2) Draw the condensed and line structures for the following compounds (a) 3,4-dimethylhexanoic acid (b) Phenylacetic acid (c) 3,4-dinitrobenzoic acid (d) 2,2,3-triflurobutanoic acid (e) 3-hydroxybutanoic acid (1) o-hydroxybenzoic acid (g) a-aminopropionic acid 3) Name the following dicarboxylic acids (use both IUPAC and common names) Он (а) НО ОН НО. (b) он ОН ОН (d) ОН он ОН...