Question

2. The gene from question 1 is found to be mutated in a genetic disorder. The mutation is highlighted below in yellow. (The normal sequence is above.) CGTGGATCCAGAATTCTATATACTAGCTAAGATGGCCGGATTCGCTTTGGGAAGAATTCGGATCC GCACCTAGGTCTTAAGATATATGATCGATTCTACGGGCCTAAGCGAAACCCTTCTTAAGCCTAGG Explain how this mutation could potentially be corrected using a technique described in this module. TABLE 3.1 COMMON RESTRICTION ENZYMES Source Restriction Site Enzyme Create Cohesive Ends A A·G·C·T-T HindⅢ 5 3' A-A-G-C T-T T-T-C-G-A A G-A-A-T-T-C G A-A-T-T-C EcoRI5 C-T-T-A-A G GvG-A-T.С.С G G-A-T-C- 3' BamH 5 3 C-C-T-A G-G C-C T-A-G G 5 3 T-C-G-A Tad C-G-A 5. A-G-C A-G-C T 5' 3 Create Blunt Ends Alul 5 A-G-C-T C-T 3 5' A -G T-C G -A T-C-G -A 3 3' 5 C-C Haelll 5 G·G C-C-G-G G·G Smal 5 C-C-C-G-G-G C-C-CG-G-G

Answer 1

Create cohesive ends by Hemophilia influenza restriction enzyme HinIII

This restriction enzyme cutscthe existing strand at A-T and A-T bond thereby creating a cohesive strand which serves as a template for the new DNA

In the cohesive strand the mutated base pair is cut and United with the proper sequence