Create a comic strip showing how a plant makes glucose in photosynthesis! Creativity is encouraged, but...
Create a comic strip showing how a plant makes glucose in photosynthesis! Creativity is encouraged, but you need to be sure to address what is found below: Include locations, reactants, and products in the light dependent and light independent reaction. Make sure your comic shows why glucose production for plants is important! 120%
The following primer sequence was used in a Sanger sequencing reaction along with the following template,...
The following primer sequence was used in a Sanger sequencing reaction along with the following template, how many different products would be expected if the only dideoxynucleotide being used was ddTTP? Primer: 5’ TGGCGCGC 3’ Template: 5’ TGGCGCGCATGGTTTAGCGCGCCA 3’ a. 6 b. 5 c. 4 d. 3 e. 2
1.Which of the following modification marks a protein for degradation in proteasomes? A.) Phosphorylation B.)ubiquitinylation C.)...
1.Which of the following modification marks a protein for degradation in proteasomes? A.) Phosphorylation B.)ubiquitinylation C.) acetylation D.) glycosylation 2. A reaction with a positive ∆G value can be made energetically favorable by increasing the A.) Delta G B.)starting concentration of products C.) strting concentration of freactants (substrates) D.) a or b
For the following incomplete half reaction equation: PbO2(s) + 4 H+(aq) + SO42-(aq) → PbSO4(s) +...
For the following incomplete half reaction equation: PbO2(s) + 4 H+(aq) + SO42-(aq) → PbSO4(s) + 2 H2O (l) On which side should electron(s) be added to make it charge balanced (reactants or products)? How many electrons should be added? (write a number) Is this an example of oxidation or reduction?
Provide the missing species as eitherreagents/reaction conditions structure of reactant or major product include any appropriate...
Provide the missing species as eitherreagents/reaction
conditions structure of reactant or major product include any
appropriate stereochemistry.provide intermediate products in multi
step processes.
2x . CHCI, кон cix-3-hexene terecyclopentane - methylenecyclopentane v. 2x 1) Cl, CH C12 2) 2 KOH, EtOH, heat
It is hard to read but it says AgNO3/EtOH 3. Give the complete reaction mechanisms, showing...
It is hard to read but it says AgNO3/EtOH
3. Give the complete reaction mechanisms, showing reactants, intermediates and products for the reactions of 1-chloro-2-butene in AgNOEtOH. You do not need to show transition states. Show appropriate stereochemistry 3b. Would you expect the product(s) to be optically active? Explain.
The equilibrium constant, Kc, for the following reaction is 77.5 at 600 K. CO(g) + Cl2(g)...
The equilibrium constant, Kc, for the following reaction is 77.5 at 600 K. CO(g) + Cl2(g) COCl2(g) Calculate the equilibrium concentrations of reactant and products when 0.325 moles of CO and 0.325 moles of Cl2 are introduced into a 1.00 L vessel at 600 K. [CO] = M [Cl2] = M [COCl2] = M
The equilibrium constant, Kc, for the following reaction is 83.3 at 500 K. PCl3(g) + Cl2(g)...
The equilibrium constant, Kc, for the following reaction is 83.3 at 500 K. PCl3(g) + Cl2(g) ⇌ PCl5(g) Calculate the equilibrium concentrations of reactant and products when 0.253 moles of PCl3 and 0.253 moles of Cl2 are introduced into a 1.00 L vessel at 500 K. [PCl3] = ___ M [Cl2] = ___ M [PCl5] = ___M
The equilibrium constant, Kc, for the following reaction is 1.20×10-2 at 500 K. PCl5(g) PCl3(g) +...
The equilibrium constant, Kc, for the following reaction is 1.20×10-2 at 500 K. PCl5(g) PCl3(g) + Cl2(g) Calculate the equilibrium concentrations of reactant and products when 0.287 moles of PCl5(g) are introduced into a 1.00 L vessel at 500 K. [ PCl5] = M [PCl3] = M [Cl2] = M
If 20 g of Na2SO4 is reacted with 20 g of Al(NO3)3 according to the following...
If 20 g of Na2SO4 is reacted with 20 g of Al(NO3)3 according to the following equation: 3 Na2SO4 + 2 Al(NO3)3 --> Al2(SO4)3 + 6 NaNO3 How many grams of the excess reactant will remain after the reaction, assuming that all of the limiting reactant reacts to form the products?
Create a comic strip showing how a plant makes glucose in photosynthesis! Creativity is encouraged, but you need to be sure to address what is found below: Include locations, reactants, and products in the light dependent and light independent reaction. Make sure your comic shows why glucose production for plants is important! 120%
Provide the missing species as eitherreagents/reaction
conditions structure of reactant or major product include any
appropriate stereochemistry.provide intermediate products in multi
step processes.
2x . CHCI, кон cix-3-hexene terecyclopentane - methylenecyclopentane v. 2x 1) Cl, CH C12 2) 2 KOH, EtOH, heat
It is hard to read but it says AgNO3/EtOH
3. Give the complete reaction mechanisms, showing reactants, intermediates and products for the reactions of 1-chloro-2-butene in AgNOEtOH. You do not need to show transition states. Show appropriate stereochemistry 3b. Would you expect the product(s) to be optically active? Explain.
Most questions answered within 3 hours.