Problem

A widely used method for calculating the annealing temperature for a primer used in PCR is...

A widely used method for calculating the annealing temperature for a primer used in PCR is 5 degrees below the Tm (°C), which is computed by the equation 81.5 + 0.41 × (%GC) – (675/N), where %GC is the percentage of GC nucleotides in the oligonucleotide and N is the length of the oligonucleotide. Notice from the formula that both the GC content and the length of the oligonucleotide are variables. Assuming you have the following oligonucleotide as a primer, compute the annealing temperature for PCR. What is the relationship between Tm (°C) and %GC? Why? (Note: In reality, this computation provides only a starting point for empirical determination of the most useful annealing temperature.)

5ʹ–TTGAAAATATTTCCCATTGCC–3ʹ

Step-by-Step Solution

Request Professional Solution

Request Solution!

We need at least 10 more requests to produce the solution.

0 / 10 have requested this problem solution

The more requests, the faster the answer.

Request! (Login Required)


All students who have requested the solution will be notified once they are available.
Add your Solution
Textbook Solutions and Answers Search
ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT