Homework Answers
Add Answer to:
Steps 6.1 to 6.4 resonance Structure [3 points) a is the sequence of the other DNA...
RNA differs from DNA in that it: all of the above contains ribose sugar contains uracil...
RNA differs from DNA in that it: all of the above contains ribose sugar contains uracil is usually found as a single-stranded molecule in cells Question 21 pts The correct order of steps in a PCR cycle is: Extension, denaturation, annealing Annealing, extension, denaturation Annealing, denaturation, extension Denaturation, annealing, extension The goal of the polymerase chain reaction (PCR) is to: Amplify a small amount of DNA sequence Cleave DNA molecules Digest bacterial plasmids Sequence DNA Which of the following is...
Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’-...
Use the following DNA sequence as the template strand to answer these questions. (8 points) 5’- GAT CCT GCC TAA -3’ Draw the non-template DNA sequence, the mRNA sequence and the resulting peptide. Label the terminus of the DNA and peptide!! Draw a point mutation. Is this a transition mutation or transverse mutation? Did it change the amino acid sequence(draw out the peptide)? 4 bp insertion, and the resulting peptide. 2 bp deletion, and the resulting peptide. A copy number...
Date: EXERCISE 18 uestions for Thought and Discussion Regarding the Structure of DNA: 1. The basic...
Date: EXERCISE 18 uestions for Thought and Discussion Regarding the Structure of DNA: 1. The basic building block of a nucleic acid (DNA or RNA) is called a and consists of three parts. The three parts are: A. B. C. 2. Describe TWO basic differences between the structure of DNA and the structure of RNA: A. B. 3. Describe the basic difference between the function of DNA and RNA: 4. Name (write out) the names of the FOUR bases of...
A. Draw the chemical structure of the GC base pair as found in human DNA. Circle...
A. Draw the chemical structure of the GC base pair as found in human DNA. Circle all hydrogen bonds. B. Add the structures of both deoxyribose sugars as they would be linked to the bases in diagram, and diagram both of the four phosphodies adjacent base pairs. your ter linkages between this base pair and
Genetics To answer the prompts below, you will need to draw the chemical structure of the...
Genetics To answer the prompts below, you will need to draw the chemical structure of the trinucleotide 5' - TCA - 3', labeling the 5' and 3' ends. Opposite this structure, draw the complementary trinucleotide to make a double-stranded DNA molecule. a. What is the complementary trinucleotide sequence from 5' to 3' (enter answer e.g. CGA) b. How many non-covalent hydrogen bonds stabilize this structure? c. How many covalent phosphate linkages stabilize this structure?
oo O OH 4 Marks) a. Is the above structure nucleotide or nucleoside? b. Give the...
oo O OH 4 Marks) a. Is the above structure nucleotide or nucleoside? b. Give the full name for the red structure? C. This structure is considered as a part of DNA OG RNA? d. What is the name of the complementary base for the base present in the above structure? How many hydrogen bonds should exist between this base-pair? e. Is the nucleobase present in the above structure aromatic or not aromatic? Prove your answer IS Marks a. What...
You have a piece of double stranded DNA that is 300 base pairs and 50% guanine...
You have a piece of double stranded DNA that is 300 base pairs and 50% guanine remember there are 2 nucleotides in a base pair 1, How many H bonds hold the strands together? 2. How many purines are in the molecule? 3. How many pyrimidines in this molelcule? 4 Would you expect this strand to "melt" at a higher or lower temperature than AT rich DNA?
3. (3 points) What is the sequence of the double-stranded DNA that is determined from the...
3. (3 points) What is the sequence of the double-stranded DNA that is determined from the following " page. You must label the ends of the double-stranded molecule. old school" Sanger sequencing gel? The top of the gel is towards the top of the ddATP ddCTP ddGTP ddTTP
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the...
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include...
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS
Date: EXERCISE 18 uestions for Thought and Discussion Regarding the Structure of DNA: 1. The basic building block of a nucleic acid (DNA or RNA) is called a and consists of three parts. The three parts are: A. B. C. 2. Describe TWO basic differences between the structure of DNA and the structure of RNA: A. B. 3. Describe the basic difference between the function of DNA and RNA: 4. Name (write out) the names of the FOUR bases of...
A. Draw the chemical structure of the GC base pair as found in human DNA. Circle all hydrogen bonds. B. Add the structures of both deoxyribose sugars as they would be linked to the bases in diagram, and diagram both of the four phosphodies adjacent base pairs. your ter linkages between this base pair and
oo O OH 4 Marks) a. Is the above structure nucleotide or nucleoside? b. Give the full name for the red structure? C. This structure is considered as a part of DNA OG RNA? d. What is the name of the complementary base for the base present in the above structure? How many hydrogen bonds should exist between this base-pair? e. Is the nucleobase present in the above structure aromatic or not aromatic? Prove your answer IS Marks a. What...
You have a piece of double stranded DNA that is 300 base pairs and 50% guanine remember there are 2 nucleotides in a base pair 1, How many H bonds hold the strands together? 2. How many purines are in the molecule? 3. How many pyrimidines in this molelcule? 4 Would you expect this strand to "melt" at a higher or lower temperature than AT rich DNA?
3. (3 points) What is the sequence of the double-stranded DNA that is determined from the following " page. You must label the ends of the double-stranded molecule. old school" Sanger sequencing gel? The top of the gel is towards the top of the ddATP ddCTP ddGTP ddTTP
If the sequence of the 5'-3'DNA strand is AATGCTAC, then the complementary DNA sequence has the following sequence o 3-AATGCTAC-5' 3'-CATCGTAA-5 3-GTAGCATT-5 3-TTACGATG-5 Question 2 20 pts Which of the following does the enzyme primase make? phosphodiester linkages (bonds) Okazaki fragments RNA primer DNA primer In which direction does DNA replication take place? 3'to 5 5'to 5 5'to 3 3'to 3 Question 4 20 pts Which enzyme unwinds the double-stranded helical DNA starting at the origin of replication? ligase primase...
8. Draw chemical structure of a double strand DNA molecule of following DNA template S'CT3. Include the phosphodiester and all hydrogen bonds. (7) 9. If you cut the following double stranded DNA fragment with a restriction enzyme with restriction site of 5'GAATTC 3" and the cutting point between A and G. Draw the structure of resulting fragments. Specify and name the end of the fragments. (8) 5" ACCTTGTGAATTCTAGGCAT3 3' TGGAACACTTAAGATCCGTAS
Most questions answered within 3 hours.
-
Where is the error in this code sequence?
String s1 = "Hello";
String s2 = "ello";...
asked 10 months ago -
Financial data for Joel de Paris, Inc., for last year
follow:
Joel de Paris, Inc.
Balance...
asked 10 months ago -
Consider this reaction:
Al2(SO4)3 (aq)+ BaCl3
(aq) Al2Cl6 (aq)- +
3BaSO4(s) . What is the...
asked 10 months ago -
Suppose that Savneet is considering increasing her
recent random sample from 20 car rentals to 40...
asked 10 months ago -
Trucks arrive at an unloading terminal at an average rate of 120
per hour.
Trucks arrive...
asked 10 months ago -
Why are methanol and ethanol completely soluble in water while
octanol is not very little soluble....
asked 10 months ago -
A facilities manager at a university reads in a research report
that the mean amount of...
asked 10 months ago -
When the CuSO4 is rehydrated by adding water to the anhydrous
compound, is this an endothermic...
asked 10 months ago -
A ray of sunlight is passing from diamond into crown glass; the
angle of incidence is...
asked 10 months ago -
A block of mass 0.249 kg is placed on top of a light, vertical
spring of...
asked 10 months ago -
how do the kidneys compensate in the presences of acidosis
a) trigger hyperventilate
b) reserve acid...
asked 10 months ago -
Question 501 pts
The rental rate of capital to the firm increases. Which of the
following...
asked 10 months ago