Question

You have a piece of double stranded DNA that is 300 base pairs and 50% guanine remember there are 2 nucleotides in a base pai

0 0
Add a comment Improve this question Transcribed image text
Answer #1

1. Since this 300 base pair DNA as per the Chargaffs rule Guanosine pairs with Cytosine by 3 H2 bonds and Adenine binds with Thymine by 2 H2 bonds , Also 50% Guanosine is present hence 150 GC pair is present 150 AT pair is present.

150 GC pair = 150 × 3 Hydrogen bond = 450

150 AT pair= 150 × 2 Hydrogen bond = 300

Hence total 750 hydrogen bond is present.

2. 300 purines are present : 150 G + 150 A

3. 300 pyrimidines are present. 150 C + 150 T

4. This GC pair melts at a higher temperature than AT rich pair as AT rich pair is very weak and melts at a very low temperature

Add a comment
Know the answer?
Add Answer to:
You have a piece of double stranded DNA that is 300 base pairs and 50% guanine...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • A 100 base pair double strand is 20% A (remember base pairs) 1. How many bases...

    A 100 base pair double strand is 20% A (remember base pairs) 1. How many bases ( in number) are T? 2. What percentage of bases are C? 3. How many hydrogen bonds hold the strands together?

  • A double-stranded DNA molecule of 175 base pairs long had (A+T/(G+C) = 0.75. How many adenine...

    A double-stranded DNA molecule of 175 base pairs long had (A+T/(G+C) = 0.75. How many adenine nucleotides are there in this DNA? 75 37.5 150

  • 1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a....

    1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a. If the DNA contains 28% adenosine residues, how many guanosine residues are in the DNA? b. Are the nucleotide compositions of each of the two individual strands of DNA identical? Explain. c. If the DNA is entirely in the B-DNA conformation: i. How many helical turns does the DNA contain? ii. What is the length of the DNA? 2. Write the sequence of a...

  • Regarding the four bases in DNA, the double-stranded DNA molecule is held together by complementary bases....

    Regarding the four bases in DNA, the double-stranded DNA molecule is held together by complementary bases. In the DNA molecule, guanine binds with ____________ and adenine binds with ____________ in DNA; in RNA, adenine binds with _____________ instead. Therefore, if the codon on the DNA strand is CAG, then the mRNA codon that will bind to it will be _______________.

  • 3. Shown below is a double stranded DNA. Replicate this DNA fragment and show the products...

    3. Shown below is a double stranded DNA. Replicate this DNA fragment and show the products formed from this replication. Remember, in replication, each strand is copied into a new daughter strand. In your answer, indicate which strands are the new daughter strands (mark with D) and which strands are the already existing parent strands (mark with P as shown below). Label the 5’ and 3’ ends of all DNA. HINT: You should have 2 double-stranded DNA fragments after replication....

  • 1. Very simple toy model for base-pairing of double stranded DNA. (This problem is originally due...

    1. Very simple toy model for base-pairing of double stranded DNA. (This problem is originally due to Kittel.) DNA is an important biological heteropolymer. A single DNA molecule base-pairs with a complementary DNA molecule to form a duplex double stranded structure. Consider two strands of complementary DNA. Each strand has N monomers. Each monomer is cross- linked by base-pairing to the corresponding monomer on the complementary DNA molecule. Suppose that the energy for breaking a cross link is є and...

  • Regarding the four bases in DNA, the double-stranded DNA molecule is held together by complementary bases....

    Regarding the four bases in DNA, the double-stranded DNA molecule is held together by complementary bases. In the DNA molecule, guanine binds with ____________and adenine binds with ____________ in DNA; in RNA, adenine binds with _____________ instead. Therefore, if the codon on the DNA strand is CAG, then the mRNA codon that will bind to it will be _______________. For the DNA codon GAT, the amino acid that would result would be__________________. The following questions relate to chs. 3 and...

  • In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA...

    In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT

  • DNA is formed by building blocks called __________. nucleotides nitrogenous bases polypeptides deoxyribose 0.5 points   ...

    DNA is formed by building blocks called __________. nucleotides nitrogenous bases polypeptides deoxyribose 0.5 points    QUESTION 2 What does DNA stand for? Double-stranded Nucleic Acid Ribonucleic acid Deoxyribonucleic Acid Double-helix Nucleic Acid 0.5 points    QUESTION 3 The nucleotides of DNA are held together by ___________. ionic bond hydrogen bond phosphodiester bond sugar-phosphate backbone 0.5 points    QUESTION 4 DNA nucleotides with one-carbon nitrogen ring bases are called ________. adenines purines pyrimidines guanines 0.5 points    QUESTION 5 Basic...

  • Double stranded DNA consists of two long strands. An adenine on one strand is always paired...

    Double stranded DNA consists of two long strands. An adenine on one strand is always paired to a thymine on the opposite strand and a guanine on one strand is always paired to a cytosine on the opposite strand. If a purified DNA has 36% thymine, what arc the percentages of the other bases? A solution has 10 mu g/L of enzyme X, how much enzyme X is in each of the following amounts of solution. 100 mL 50 mL...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT