Question

In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy su
0 0
Add a comment Improve this question Transcribed image text
Answer #1

The dsDNA1 has more GC base pairs than that of the dsDNA2.

Since there are three hydrogen bonds between GC or CG base pairs. Therefore dsDNA1 has more number of hydrogen bonds than that of the dsDNA2.

Hence the melting temperature of of ds DNA1 is higher than the dsDNA2. As such dsDNA1 requires more energy to get denatured.

Therefore the dsDNA 2 will require less energy to be separated.

Thank you

Add a comment
Know the answer?
Add Answer to:
In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • 6a. Dissociation of the double stranded DNA helix into single coils is referred to as DNA...

    6a. Dissociation of the double stranded DNA helix into single coils is referred to as DNA melting. In this process, two strands of a DNA molecule can be separated by heat without breaking any covalent bonds. Every unique DNA molecule “melts” at a different temperature. Determine the order of the DNA sequences listed below according to relative melting temperatures (lowest Tm to highest Tm). Assume that they all begin as stable double-stranded DNA molecules. [3 pts] A. CTGAATCA B. CAGTGTCT...

  • Single stranded DNA (ssDNA) is a product of DNA denaturation. When compared to double stranded DNA...

    Single stranded DNA (ssDNA) is a product of DNA denaturation. When compared to double stranded DNA (dsDNA) it is much more flexible with its persistence length (lp) estimated to be an order of magnitude lower than that for dsDNA. If a particular dsDNA sequence has a (4-63 nm): a) Estimate at what concentration of NaCl dsDNA flexibility is comparable to that of ssDNA [NaCl]- a) Estimate at what concentration of MgCl2 dsDNA flexibility is comparable to that of SSDNA [MgCl2]-

  • Two complementary strands of DNA can exist in solution in the form of a duplex (double-stranded...

    Two complementary strands of DNA can exist in solution in the form of a duplex (double-stranded form) or can exist as separate strands ("random coils"), depending on the position of the equilibrium shown below. Double-stranded form < = = > single strands ("random coil") With regard to Enthalpy and Entropy, match the interactions that favor the form of DNA listed. What is the enthalpic term favoring single stranded DNA? A. Hydrogen Bonding B. Conformational C. Base Stacking D. van der...

  • The partial sequence of one strand of a double stranded DNA molecule is: 5’ ---GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG--- 3’...

    The partial sequence of one strand of a double stranded DNA molecule is: 5’ ---GACGAAGTGCTGCAGAAAGTCCGCGTTATAGGCATGAATTCCTGAGG--- 3’ Write the sequence of both strands of the DNA fragment when this DNA is cleaved with both EcoRI and PstI. The top of your duplex DNA fragment should be derived from the standard sequence given above.

  • 1. Very simple toy model for base-pairing of double stranded DNA. (This problem is originally due...

    1. Very simple toy model for base-pairing of double stranded DNA. (This problem is originally due to Kittel.) DNA is an important biological heteropolymer. A single DNA molecule base-pairs with a complementary DNA molecule to form a duplex double stranded structure. Consider two strands of complementary DNA. Each strand has N monomers. Each monomer is cross- linked by base-pairing to the corresponding monomer on the complementary DNA molecule. Suppose that the energy for breaking a cross link is є and...

  • DNA is a double-stranded molecule where two polynucleotide strands run antiparallel to each other, and the...

    DNA is a double-stranded molecule where two polynucleotide strands run antiparallel to each other, and the bases on one strand are complementary to the bases on the opposite strand. If one strand of a DNA molecule has the following sequence of bases, what would the sequence be for the complementary, antiparallel DNA strand? 3' GCTGATCAGGAC 5'

  • 1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a....

    1. Answer the following questions concerning a section of double-stranded DNA containing 1000 base pairs. a. If the DNA contains 28% adenosine residues, how many guanosine residues are in the DNA? b. Are the nucleotide compositions of each of the two individual strands of DNA identical? Explain. c. If the DNA is entirely in the B-DNA conformation: i. How many helical turns does the DNA contain? ii. What is the length of the DNA? 2. Write the sequence of a...

  • One of the DNA parental strands is 5’ ACCTCATCG 3’. The Boldface C was deaminated(and the...

    One of the DNA parental strands is 5’ ACCTCATCG 3’. The Boldface C was deaminated(and the mutation was not repaired). This strand does not get transcribed, the other one does. a) Predict the double stranded sequence of both dsDNA molecules made after one round of replication. Label the parental vs daughter strands in each ds molecule b) For each dsDNA mol (in part a) predict the RNA sequence if transcription occurred.

  • Only one strand of a double stranded DNA fragment is shown below. This DNA encodes a...

    Only one strand of a double stranded DNA fragment is shown below. This DNA encodes a beginning of a polypeptide. GTGATGCGGCGCGCGCCACCACATGTGAAAAAATAACTCCGGCATTACGAACCTCGAAGAATCGGGATTTAGCCATTATAGCTAGCC 1. Write down the sequence of mRNA which will be transcribed from this DNA. Hint: it is impossible to identify the first base of a mRNA accurately from just sequence analysis, therefore, chose the first base within plus-minus 2 bp from a real start. (10 points) ABC 2. Write the N-terminal portion of polypeptide which is encoded by this...

  • Draw a figure of one double stranded DNA molecule that has initiated replication and produced two...

    Draw a figure of one double stranded DNA molecule that has initiated replication and produced two okazaki fragment in each lagging strand. The figure must include both template strands, all newly synthesized DNA molecules on both leading and lagging strands, all RNA primers, direction of chain growth for each fragment/strand indicated with arrowheads, direction of replication forks. Each molecule must be labeled with the origin of replication on both strands, leading and lagging strands labeled, template or newly synthesized, DNA...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT