Question

Two complementary strands of DNA can exist in solution in the form of a duplex (double-stranded...

Two complementary strands of DNA can exist in solution in the form of a duplex (double-stranded form) or can exist as separate strands ("random coils"), depending on the position of the equilibrium shown below. Double-stranded form < = = > single strands ("random coil") With regard to Enthalpy and Entropy, match the interactions that favor the form of DNA listed.

What is the enthalpic term favoring single stranded DNA?

A. Hydrogen Bonding

B. Conformational

C. Base Stacking

D. van der Waals

E. Electrostatic

F. Cannot favor single stranded DNA

What is the entropic term favoring single stranded DNA?

Electrostatic, Hydrogen Bonding, conformational, Base Stacking, van der Waals, or Cannot favor single stranded DNA

What is the enthalpic term favoring double stranded DNA?

Hydrophobic Effect, Hydrogen Bonding, van der Waals, Electrostatic, Conformational, Cannot Favor double stranded DNA

What is the entropic term favoring double stranded DNA?

Electrostatic, Hydrogen bonding, Conformational, Base Stacking, van der Waals, or Cannot favor single/double stranded DNA

0 0
Add a comment Improve this question Transcribed image text
Answer #1

1) Entahlpic term f) cannot favour single stranded DNA

2) Entropic term favoring single stranded DNA is the Base stacking interaction.  

As, Single-stranded DNA does not have the base pairing interaction found in dsDNA. However, some ssDNA shows base stacking interaction, which can significantly affect its elasticity and conformation.

3) The enthalpic term involved in double stranded DNA is hydrogen bonding, hydrophobic effect, van der waal force

4) The entropic term that is involved in dsDNA is Conformational and Base stackinh

Add a comment
Know the answer?
Add Answer to:
Two complementary strands of DNA can exist in solution in the form of a duplex (double-stranded...
Your Answer:

Post as a guest

Your Name:

What's your source?

Earn Coins

Coins can be redeemed for fabulous gifts.

Not the answer you're looking for? Ask your own homework help question. Our experts will answer your question WITHIN MINUTES for Free.
Similar Homework Help Questions
  • [Choose] Coats single-stranded DNA, preventing duplex formation Replaces RNA primers with DNA nucleotides breaks hydrogen bonds,...

    [Choose] Coats single-stranded DNA, preventing duplex formation Replaces RNA primers with DNA nucleotides breaks hydrogen bonds, unwinding DNA double helix Synthesizes DNA 5' to 3' on leading and lagging strands Relaxes supercoiled DNA Catalyzes phosphodiester bond formation, joining DNA fragments Leading strand Lagging strand synthesizes RNA primers on leading and lagging strands [Choose)

  • 1. Very simple toy model for base-pairing of double stranded DNA. (This problem is originally due...

    1. Very simple toy model for base-pairing of double stranded DNA. (This problem is originally due to Kittel.) DNA is an important biological heteropolymer. A single DNA molecule base-pairs with a complementary DNA molecule to form a duplex double stranded structure. Consider two strands of complementary DNA. Each strand has N monomers. Each monomer is cross- linked by base-pairing to the corresponding monomer on the complementary DNA molecule. Suppose that the energy for breaking a cross link is є and...

  • In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA...

    In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT

  • Enter your answer in the provided box. Given two complementary strands of DNA containing 1.01 X...

    Enter your answer in the provided box. Given two complementary strands of DNA containing 1.01 X 102 base pairs each, calculate the ratio of two separate strands to hydrogen-bonded double helix in solution at 3.49 x 10² K. (Hint: The formula for calculating this ratio is e-SE/RT, where AE is the energy difference between hydrogen-bonded double-strand DNAs and single-strand DNAs and R is the gas constant.) Assume the energy of hydrogen bonds per base pair to be 7.70 x 102...

  • 1. A. In order to translate DNA into peptides Nature uses codons that contain how many...

    1. A. In order to translate DNA into peptides Nature uses codons that contain how many bases? 1 2 4 5 B. The major forces/bonds that holds phospholipid membranes together is _________________. van der Waal forces electrostatic interactions electrostatic interactions disulfides covalent bonds C. Which of the following is not a role that proteins play? Act as nutrients when taken in as a food source Catalyze reactions Form membranes Allow organisms to move (muscles) D. Biological membranes are semi-permeable. One...

  • Question 2a Deoxyribonucleic acid (DNA) is made up of nucleotides. Which part of the nucleotide stabilizes...

    Question 2a Deoxyribonucleic acid (DNA) is made up of nucleotides. Which part of the nucleotide stabilizes the structure of DNA using weak van der Waals interactions (stacking) and using hydrogen bonds? (Note that covalent bonds are not included in that sentence.) a. the deoxyribose sugar b. the ribose sugar c. the phosphate d. the nitrogenous base e. the amino acid Question 2b This ability of the nitrogenous bases to exist in more than one form can lead to incorporation of...

  • group on the 13. In double-stranded DNA, a pyrimidine group on one strand base pairs with...

    group on the 13. In double-stranded DNA, a pyrimidine group on one strand base pairs with a other strand; the two strands are oriented in directions. a. purine, parallel b. purine, antiparallel c. pyrimidine, parallel d. pyrimidine, antiparallel Questions 14 and 15 refer to the following information: A disaccharide composed of arabinose and xylose gives arabinose and xylonic acid by reaction with Bry-water followed by hydrolysis. Reaction of its methyl glycoside with iodomethane under basic conditions followed by hydrolysis gives...

  • DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in...

    DNA DNA Replication: ONA Because DNA Is the ge m Tumes and heart e ine in process called DNA curs in the nucleus of s acest FS Parent strand Parent strand Newly replicated DNA Newly replicated DNA- SA0 Daughter DNA molecule Daughter DNA molecule Figure 8.2: Overview of DNA replication and illustration of complementary base pairing. DNA must replicate before cell division so that each new daughter cell receives an exact copy of the parent DNA. 1. Replication begins when...

  • Which of the following is TRUE of incomplete penetrance? Select one: a. Epistatic interactions can result...

    Which of the following is TRUE of incomplete penetrance? Select one: a. Epistatic interactions can result in incomplete penetrance in some cases. b. Environmental factors do not influence penetrance. c. Incomplete penetrance implies that some individuals will experience less severe forms of disease, such as cancer or Alzheimer's. d. Incomplete penetrance is never observed with Huntington's disease e. Incomplete penetrance refers to cases in which individuals developing a particular disease (e.g., cancer or Alzheimer's) lack the typical genotype for this...

ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
ADVERTISEMENT