HomeworkLib
Search
Solutions
Q&A
Blog
Scan Question
+ Post
Ask a Question
Post a Question (with Answer)
Post a Blog
Get Coins
Log In
Sign Up
Home
/
Topics
/
Biology
/
Biology Questions
Biology Questions
what kind of memebrane lipids are unquie to the archea species ?
QUESTION 1 Match the Federal Agency with the roles that follow: Lead agency for prevention,...
The hydrolysis of pNG results in the formation of one molecule of pNit. However, the hydrolysis...
Question 1: What is lactated dehydrogenase, and how is it used in the reduction of carbonyl...
Using components from all three types of eukaryotes organisms, design an ideal organism, and explain your...
There are different techniques applied to analyze gene expression levels during biotechnological or pharmaceutical drug development....
18. Describe one reason why the cell might want chromatin to be more tightly packaged during...
What are promoters? Why is a strong and regulated bacteria lpromoter required for protein expression?
What are the five results of humoral antigen-antibody binding? List and define each.
1)Linolenic acid is an essential fatty acid. True or False 2)Linoleic acid is the parent member...
Calculate the water potential of a cell with no cell wall that has 0.5 M sugar...
2) Using specific examples describe the homeostasis and negative feedback in humans. 3)Define Taxonomy, nomenclature, systematics...
Outline the major steps for how TLR 4 might activate SAPK pathway. Outline the steps necessary...
Discuss the differences between the upper and the lower respiratory tract with regard to infections and...
Biodiversity Ecologists are interested in quantifying different kinds of biodiversity. In each of the two studies...
Birds of paradise are beautiful birds often with spectacularly long tails. The male birds will often...
Hello please help Selective and Differential Media – What media you would use to identify your...
In an SDS-PAGE, what would happen if the separating gel had been prepared with Tris-HCl buffer,...
Today, most good laboratory microscope are parfocal; that is, the slide should be in focus
In terms of genetic makeup explain why evolution applies to populations and not to individual members...
Identify three fungal infections of plants or animals and the fungi responsible for the infections.
Myocardium (cardiac muscle tissue) must rhythmically contract for a lifetime. This requires a considerable amount of...
9. Photosynthetic phosphorylation and oxidative phosphorylation are similar processes. All of the following are common to...
Can the extinction rate be equivalent to the origination rate for a group? Describe what would...
Question: Need help with a brief summary (3-4 sentences) of this research for a lay audience....
how does knowledge of Cellular Biology help you in pharmaceutical /biotech company ?
With examples discuss the past and present role of plants in medicine. Make sure to include...
In the Wallach Orientation Center (next to the Hall of Vertebrate Origins), grab a handout that...
What would be the evolutionary advantage to having the conduction velocity of neural impulses change with...
An RNA molecule has the following sequence: ’UCAAUGCUUAAGAAGGCAUGAAAUAA 3’ Label the protein-coding region of this mRNA,...
What is the normal pathway from DNA to proteins? ____________ à _____________ à ____________ What do...
c)You have 0.6 mL an undiluted culture at a density of 3.7 x 107 CFU/mL. You...
Active transport of solutes across a membrane ____ energy input, and ____ need the involvement of...
Regarding the electron transport chain (ETC)...How many ATPs are produced from one NADH? From one FADH2?...
How is the pathological state recognized. Compare normal & abnormal by looking at structures in the...
what would happen to the 3rd stage of respiration if we add a "drug" that takes...
4. Understand the Monohybrid Cross example dealing with flower color in pea plants. How is a...
Two heterozygous red-eyed flies are crossed. The results are shown below. Determine the chi-square value and...
The time between when you feed a rotifer and when the first food was eliminated is...
illustration of the fluid mosiac model thag shows glucose be passed through cell membrane. label all...
Explain the problem of zebra mussels, and invasive species (see Case Study 11.1 in Natural Resource...
How is Arsenic toxic for aquatic biota? ALSO, Provide TWO examples.
1. Consider the thrifty phenotype hypothesis of health disparities. a. Briefly explain what this theory suggests...
Which of the following components of the light dependent reactions is NOT involved in redox reactions?...
The main groups of bryophytes include all except _____. A. Hornworts B. Liverworts C. Mosses D....
A recently married couple would like to start a family. They are both heterozygous for albinism,...
I need help Bug Population changes when there is a breeding preference for blue rimmed bugs...
Explain the principle of nitrate reduction test? (b) Alpha hemolysis (c) Beta hemolysis (d) Gamma hemolysis.
Protein Folding - a) what is the molten globule? b) How does the activity of chaperones...
what are the three basic properties shared by all enzymes?
easy histology question , please choose an answer transcriptional complex is preset In which of the...
A sperm cell of Equus caballus (horse) contains 32 chromosomes in its nucleus. a. How many...
Graph energy expenditure versus velocity in macropodids. What enables micropodids to be so efficient?
If a gene is 500 nucleotides long, how many characters could be evaluated in total and...
how do you make 500mL of TE buffer (20mM Tris-HCl, 0.75mM EDTA)
which of the following is not a recommended strategy for treating an ulcer? Avoid aggravating foods...
What is the basic idea of natural selection? What is evolutionary adaption? Describe the five types...
Neuronal cell death during embryonic development of the mammalian brain: a. is a normal and desirable...
Unicellular Eukaryote: Amoeba 1. Does Amoeba have a definite shape? if not, why not? 2. What...
Your laboratory is investigating the genetic regulation of programmed cell death in a Mungonian fly. Design...
Null and alternative hypotheses are logically equivalent. Select one: True False
Under which of the following species concepts might horses and zebras be considered different species? (Choose...
1. Which of the following is/are required for natural selection to occur? A. The trait must...
if you wanted to isolate E. coli from a polymicrobial culture, what would be the best...
33. Evidence suggests that _____ of ______ from nucleosomes in the wake of an elongating RNA...
This class of fishes are the ancestors to amphibians and the amniotes. A) Petromyzontida B) Sarcopterygii...
When ATP is hydrolyzed: A. water is formed and released as a reaction product. B. the...
QUESTION 18 Following activation of a mitogenic signaling pathway, which of these events occur to promote...
Following intensive exercise, which of the following would be expected to occur? A.Increased production of 2,3-BPG...
In the Carbon Cycle, it is said that dead animals can turn into fossil fuels. How...
USING THE CompleteD the Punnett square below when the parents are BB and bb. Punnett Square...
How much acid can a tablet neutralize if the tablet contains 500 mg of Ca(OH)2? Rxn:...
Dehybrid cross of F1 and F2 generation what is the Phenotype and genotype Ratio: 1). White...
You are studying a cell which, before the S phase of the cell cycle, has 8...
Could IGFR be a major effector in diseases other than diabetes and heart disease? If So,...
Is it possible to have 2 or more genes coded for along the same overlapping section...
Escherichia coli ST131 is a uropathogenic strain (aka UPEC) noted for being multiply-drug resistant and its...
Which of the following pairs of people would provide the most useful information to geneticists regarding...
Nanobodies a. contain disulfide bridges b. consists of a recombinant protein with the small VHH c....
E.coli and P.vulgaris are examples of amensalism. what is the importance of this in nature?
‹
1
2
3
4
5
6
7
8
...
124
125
›
ADVERTISEMENT
Free Homework Help App
Download From Google Play
Scan Your Homework
to Get Instant Free Answers
Need Online Homework Help?
Ask a Question
Get Answers For Free
Most questions answered within 3 hours.
ADVERTISEMENT
Share Your Knowledge
Post an Article
+5 Coins
Post an Answer
+5 Coins
Post a Question with Answer
+5 Coins
Active Questions
probability can be expressed both as proportion and percentage true or false?
asked 2 hours ago
Im trying to create a function in C where it takes an array and size and...
asked 2 hours ago
what is the difference between a Lexeme and a Token? what do each represent?
asked 2 hours ago
Due to the inverse square law, the image at the margin of the x-ray film will...
asked 2 hours ago
Please use JAVA Create an additional drawing panel at least 400 x 400. On it, draw...
asked 3 hours ago
Write a MATLAB® script to Find the roots of the following equation ?? ? ? +...
asked 3 hours ago
2) Consumer Reports recently compared how advanced safety technologies affect the cost of car repairs. Basic...
asked 3 hours ago
You're pulling on a stationary object on the ground via a rope connected to it. What...
asked 4 hours ago
Write a java program that plays the popular scissor-rock-paper game. (A scissor can cut a paper,...
asked 6 hours ago
Accrued salaries payable of $10,000 were not recorded at December 31, 2018 and expensed in 2019.....
asked 6 hours ago
Rank the following reagents in order of pH, lowest to highest. Assume they are all soluble...
asked 6 hours ago
Consider the following scenario: • Let P(C) = 0.2 • Let P(D) = 0.3 • Let...
asked 8 hours ago
ADVERTISEMENT