6a. Dissociation of the double stranded DNA helix into single coils is referred to as DNA melting. In this process, two strands of a DNA molecule can be separated by heat without breaking any covalent bonds. Every unique DNA molecule “melts” at a different temperature. Determine the order of the DNA sequences listed below according to relative melting temperatures (lowest Tm to highest Tm). Assume that they all begin as stable double-stranded DNA molecules. [3 pts] A. CTGAATCA B. CAGTGTCT C. TTAATCAT D. CCTGCGG 6b. Explain your answer for 6a.
DNA melting :-
• In this process no covalent bond is broken whereas hydrogen bonds
are broken by temperature.
• DNA contains four bases- Guanine, Cytosine, Adenine, and Thymine.
Hydrogen bonds found between these bases.
• Double hydrogen bonds present between adenine and thymine whereas
triple hydrogen bonds present between cytosine and guanine.
• If there is more number of hydrogen bonds present in DNA, more temperature required for melting DNA.
Now, which DNA has more hydrogen bonds.
• A DNA with more number of cytosine and guanine has more hydrogen
bonds (*because triple hydrogen bonds present between them which is
more then double bonds between adenine and thymine).
So, A DNA strand with more Cytosine and guanine has higher melting
temperature with compare to others.
Now in question :-
Number of cytosine and guanine in DNA-
(A) G+C = 3
(B) G+C= 4
(C) G+C = 1
(D) G+C = 6.
So, the sequence of melting point (from low to high) will be
:-
C< A <B< D.
6a. Dissociation of the double stranded DNA helix into single coils is referred to as DNA...
QUESTION 44 west Because hydrogen bonds hold the two strands of a DNA molecule together, the strands can be separated ("melted") without breaking any covalent bonds. To melting temperature) is the point at which two strands separate, or become denatured. Order the DNA sequences listed below, according to relative meting temperatures from Tm to highest Tm). Assume that they all begin as stable double-stranded DNA molecules at room temperature i) CGGCGAGCCAGCCCCG 11) TTAATTGITTGTCTCT iii) GTACCCGTCCTGTGAC iv) CCTAATAGACGCTGOT OAI<tcllci Biliv Ochellesi...
In a test tube, a strand of double-stranded DNA can be separated into two single-stranded DNA molecules by applying energy such as heat. Sequences for two different dsDNA molecules are shown below (dsDNA 1 and dsDNA 2). Which one of these two would require less energy to be separated? Explain your reason. Note: Both dsDNA are 20 base pairs long. The sequence for only one of the strands in each dsDNA are shown dsDNA 1: GCGCACGGACGGCCCGCACC dsDNA 2: TATTAGTATACTAATAAGTT
A number of factors influence the melting properties of a linear, double-stranded DNA molecule in a 0.25M sodium chloride solution. Considering this, explain each of the following observations: (a) The Tmincreases in proportion to the length of the molecule (b) As the concentration of sodium chloride is decreased, the Tm decreases (c) Renaturation of single strands to form double strands occurs more rapidly when the DNA concentration is increased (d) The Tm value is reduced when urea is added to...
5) (3 pts) For a double-stranded DNA molecule, which of the following statements are true? If false, explain why. a. [A+C] = [G+T] b. [A+G] = [C+T) c. A=G and C=T d. A/T=C/G e. [A+T] = [G+C] f. C/A=T/G 6) (3 pts) Listed below are the base compositions of three different duplex DNA molecules. L S'ATTCTAACTTTGAT 3' 3' TAAGATTGAAACTA 5 IL S'CGCACTGGCTAACC 3' 3'GCGTGACCGATTGG 5' II. 5'CGCATTATTGTCAA 3' 3'GCGTAATAACAGTT 5' a) Order these three molecules in terms of their melting...
1. In the following double-stranded DNA sequences, ___ has the lowest melting temperature and __ has the highest melting temperature. 1) GATCG 2) GGCCG 3) AATTA 4) AATCA CTAGC CCGGC TTAAT TTAGT 2. In linear nucleic acids, nucleotides are bonded through their ___ and ___ carbon atoms. 3. Although RNA and DNA are similar in structure, one difference is that ___. DNA uses the base adenine RNA uses the base cytosine the RNA sugar...
Please show all work and answer all parts of the question. Thanks
3. When self-complementary strands of DNA are mixed, they form a double-stranded DNA at low temperatures but dissociate to single strands as the temperature is raised: T(C) A (oligoA-T) This can be observed by an increase in the absorbance of the solutions at 260 nm (The double helix is said to show "hypochromicity" at this wavelength) 10 15 20 25 30 35 40 45 50 0.720 0.732 0.740...
Shown below are the sequences of three duplex DNA molecules. I. 5" AGCCTAACTGCGAT 3' II. 5' CGCATTATTGTCAA 3' III. 5' CTAACCCGCACTGG 3' 3' TCGGATTGACGCTA 5' 3' GCGTAATAACAGTT 5' 3' GATTGGGCGTGACC 5' a. State the relationship between the percentage of AT base pairs in a double-stranded DNA molecule and the melting point of that molecule. b. Order the above three molecules (I, II, III) in terms of their melting points from lowest to highest. The graph below shows the results of...
1. Which of the following statements is FALSE? Helicase activity 'unwinds DNA making the double-stranded molecule into single strands. b. The leading strand of DNA is started by an RNA primer The lagging strand of DNA is synthesized as "Okazaki fragments", cach with its own RNA primer. DNA replication proceeds in both directions around the bacterial chromosome. DNA polymerase synthesives new DNA in one direction (3 to 5) only. 2. Which of the following would be found in eukaryotes? a....